Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15611  (registered. 2007)
Contig Information
Length 694 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 6
Wh_r Root 2
Wh_yd Spikelet at late flowering 3
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0918300 [Oryza sativa (japonica cultivar-group)] >gi|2501449|sp|P55857|SMT3_ORYSJ RecName: Full=Ubiquitin-like protein SMT3 >gi|1668773|emb|CAA67922.1| ubiquitin-like protein [Oryza sativa] >gi|18146762|dbj|BAB82439.1| ubiquitin-related protein [Oryza sativa Japonica Group] >gi|19386713|dbj|BAB86095.1| putative SUMO protein [Oryza sativa Japonica Group] >gi|57900450|dbj|BAD87743.1| putative SUMO protein [Oryza sativa Japonica Group] >gi|113534738|dbj|BAF07121.1| Os01g0918300 [Oryza sativa (japonica cultivar-group)] >gi|125528873|gb|EAY76987.1| hypothetical protein OsI_04943 [Oryza sativa Indica Group] >gi|125573116|gb|EAZ14631.1| hypothetical protein OsJ_004456 [Oryza sativa (japonica cultivar-group)] >gi|149390685|gb|ABR25360.1| ubiquitin-like protein smt3 [Oryza sativa (indica cultivar-group)] >gi|215765122|dbj|BAG86819.1| unnamed protein product [Oryza sativa Japonica Group]
Score 448
Evalue 8.37392e-43
Total Hit Count 438
Registered year 2007
Contig Sequence     [ Download ]
>Contig15611
tttgaaaatgaTGCCTCGCTACGATGAGAAACcaaatgAGTTTGCAAatcatTGGGAACACAACAAGG*CATGATATATTAGGCAATGGATGATAGTTCA
GTCACGACATCAACAGTACTCCGATGTTCTTTCACCTCCAGACCCCCCCTCAGGCTATGGCACAGAATCATAGCCTCGCAAGTTCTTTCACTTCTTACAT
TTTACTCTAGTTCTAAAGGTAGCATACGACATAGAACAGCCAGGCTGCAGCAAGCTCCTTCTAAGGGCGAGGAAAGCCCCCTCCGGTCTGGTGAAGCATG
GCGTCAATCTCGTCGCCTTCCTCCATCTCAAGCTCATCAGGGGTCTGCTCACCACGGAGCCTACGACCATCAAAAAGGAAAGCAATGGAGTTGAGATCCA
CAGACTGACGGTCGCAGTAGGCGTTCATCAGCTTCTTCAGCTGTGTGGATCTCTTGATGCGGAAGAAAACCTCATTGCCATCCTGCCCCTTGACCTTGAG
GTTGATGTGGGCGCCTCCGCCGTCGCCCGCGGGCTT*CTTGT*CCTCGTCCGCCGTCACGCCCGACATCTCCGCCGACTCCTCT*CTGCCGTGCCGCGCC
GCGAGAGGGGGGGTTGGGG*TGAGGAGCAGGGTAGGGGATCCGAGCAGGAGCAGAGGAAGAAGACGactcgagtactgtgcggcggacccgagc
page-top