Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9446  (registered. 2012)
Contig Information
Length 817 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125532489|gb|EAY79054.1|| hypothetical protein OsI_34164 [Oryza sativa Indica Group]
Score 241
Evalue 9.00E-62
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9446
TTTTTTTTTTGTGTGAAGTTCGTAAATAGCACTGCATATAACAACAGCTTCAACCATCCAGGTTCCATGTGTACAATGACTACAGAGTACTTGCAACTCT
TGTCATCAGATGTATTTCACTCAAAAGGGGGTAAAAAGACTAAGAAAACAAGCACGTTTAGCAGTACATCCTTGGAAATAACCAAAGCCCAGATTATTTT
GGTCAACAAACATGATCTAAGTTACACCGCTCAACCTAGTTAATGTGGCAGCTTGGCAATCGACCTGGAGTTTGCACGGTGTTCTGTTGTTCTTCACAAC
AAGCCTCTAGGGTTTAGTTCCACCTTGGGTAATGGACGTCGCGAGAAGACTGGGATGGCTGCACGCTCTGGCTGTTGGCACCAATGAAGCCTTGCAGAAG
GCTCTGCGCCACTCTCACTTGGTCCGGCATACCTTGGATCTCCATGATGGATTCCGAAGAACCAGGACGGGCTTCAAGCAACTTCATTCTTGCACCAGAG
ATCTGGCGGATCCCTCGTGCATTGACACCACCAGCTCCAACAATAGATTCCAGAGAACTATTTGGAATCCTCAGTTCAACAGAGCTACTTGAATACCCTG
TAACATCTGCCACTCTTTGATAATCCTCACGTCCATGCATCTGCCCGGCAGCCTCAGTGTAATCATAAGCATTGGAATTTCCGGCTCTGGTGACGCCTAA
TTGTTGCATATTACTATTCCCAGCTCTTGAGAGGCCTAATTGCTGCATGCCTCTACTAGAATAGCTATCAGTANGCATATGGTCATGATAAGAACGATGC
GACATATAATCAGCACC
page-top