Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15602  (registered. 2007)
Contig Information
Length 903 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 10
Wh_e Seed DPA10 15
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit low molecular weight glutenin subunit [Triticum aestivum] >gi|169666925|gb|ACA63861.1| low molecular weight glutenin subunit [Triticum aestivum]
Score 430
Evalue 1.66407e-40
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15602
gcaacaacAACAACCAGTACTaccgcaacaACCACCattttcgcAACAACAACAACAACAACCAATTCTACCACAACAACCATCATTTTCGCAACAACAA
CAACAACTAGTTCTACCGCAACAACAAATACCATTTGTTCATCCATCTATCTTGCAGCAGCTGAACCCATGCAAGGTATTCCTCCAGCAGCAATGCAGCC
CTGTGGCAATGCCACAAAGTCTTGCTAGGTCGCAAATGTTGCAGCAGAGTAGTTGCCATGTGATGCAACAACAATGTTGCCAGCAGTTGCCGCAAATCCC
CCAGCAATCCCGCTATGAGGCAATCCGTGCTATCATCTACTCCATCGTCCTGCAAGAACAACAACAGGTTCGGGGTTCCATCCAAACTCAGCAGCAGCAA
CCGCAACAGTTGGGCCAATGCGTTTCCCAACCCCAACAGCAGTCACAGCAGCAACTCGGGCAACAACCTCAACAACAACAATTGGCACAGGGTACCTTTT
TGCAGCCACACCAGATAGCTCAGCTTGAGGTGATGACTTCCATTGCGCTCCGTACCCTGCCAATGATGTGCCGTGTCAATGTGCCGTTGTATAGGACCAC
CACTAGTGTGCCATTT*GGCGTTGGCACT*GGAGTTGGTGCCTACTGATAAGGAAAGG*TCTCTAGTAATATATA*GTTGGATCACC*GTTGTTT*AGTC
GATGGATATGTCGATGCAGCGGTGACAAATAAAGTGTCACACAACGTCGTGTGTGACCCGCCCAAACTAGTTGTTTAAATT*CTG*AAATAAAATACAAA
TAAAGTTGTATCAAGACAATGTTCATATTgacATTGtgtggatgtcgatctgattgtcatgcttgcaagttcataagttgtctttccggtcacaagcgca
acc
page-top