Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15584  (registered. 2007)
Contig Information
Length 1951 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_dL Crown of seedling 7
Wh_h Spike at heading date 4
Wh_r Root 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative S-adenosylhomocystein hydrolase 2 [Hordeum vulgare subsp. vulgare]
Score 1976
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15584
cactcctctTCTTCCTCCTCCCTCAGCTGCCAGATCCAATCTACCAACCTTCTCCATGGCGCTCTCCGTGGAGAAGACCTCGTCGGGCAGGGAGTACAAG
GTCAAGGACCTCTCCCAGGCCGACTTCGGCCGCCTCGAGCTCGACCTCGCCGAGGTCGAGATGCCCGGCCTCATGGCCTGCCGCACCGAGTTCGGGCCCT
CGCAGCCCTTCAAGGGCGCCCGCATCTCCGGCTCCCTCCACATGACCATCCAGACCGCCGTCCTCATCGAGACCCTTACCGCGCTCGGCGCCGAGGTCCG
CTGGTGCTCCTGCAACAtgcTTCTCCACCCAGG*ACCACGCCGCCGCCGC*CATCGC*CCGCGACTCGGCCGCCGTCTTCGCCTGGAAGGGCGAGACCCT
CGAGGAGTACTGGTGGTGCACCGAG*CGCTGCCTCGACTGGGGCGCCGGCGGCGGCCCCGACCTCATCGTCGACGACGGCGGTGACGCCACGCTGCTCAT
CCACGAGGGCGTCAAGGCCGAGGAGGAGTTCGAGAAGTCCGGCAAGGTCCCCGACCCGGAGTCCACCGACAACCCCGAGTTCAAGATCGTCCTCACCATC
ATCCGCGACGGGCTCAAGACCGACGCCCACAAGTACCGCAAGATGAAGGAGAGGCTCGTC*GGTGTCTCCGAGGAGACCACCACCGGCGTCAAGAGGCTC
TACCAGATGCAGGAGTCCGGCACCCTCCTCTTCCCCGCCATCAACGTCAACGACTCCGTCACCAAGAGCAAGTTTGACAACCTTTACGGTTGCCGTCACT
CGCTCCCTGATGGTCTTATGAGGGCCACTGATGTTATGATCGCCGGCAAGGTTGCCGTGGTCTGCGGTTATGGTGATGTTGGCAAGGGCTGTGCCGCCGC
ACTTAAGCAGGCTGGTGCCCGTGTGATCGTGACAGAGATTGACCCCATATGTGCCCTTCAGGCCCTGATGGAGGGCATCCAGATCCTCACCTTGGAGGAT
GTTGTCTCTGAGGCTGATATCTTTGTGACCACCACCGGAAACAAGGACATCATCATGGTTGACCACATGAGGAAGATGAAGAACAACGCCATTGTCTGCA
ACATTGGTCACTTTGACAACGAGATTGACATGAACGGCCTTGAGACCTACCCTGGTGTCAAGCGCATCACCATCAAGCCCCAGACTGACCGCTGGGTCTT
CCCCGAGACCAAGACCGG*CATCATTGTTCTTGCTGAGGGTCGTCTGATGAACCTTGGATGTGCCACTGGCCACCCCAGCTTTGTCATGTCCTGCTCATT
CACTAACCAGGTTATTGCTCAGCTTGAGTTGTGGAACGAGAAGGCCACCGGCAAGTACGAGAAGAAGGTGTACGTTCTCCCCAAGCACCTCGACGAGAAG
GTCGCGGCCCTCCACTTGGGCAAGCTCGGCGCCAGGCTGACCAAGCTCACCAAGTCCCAGTCTGACTACATTAGCATCCCAGTTGAGGGTCCTT*ACAAG
CCTGCGGCC*TACCGGTACTAGTGTGCCCAGCACGGCTAGCGG*CTGGCCTGAGCCTGAGTCGGAGCAGCGGCACCAACGGGAACTCTATCAACTATCCT
GTTTCCCTTCTATTATCTTACATGCTGTCTCTTAGGCGGAGGATTTGTTATTATGGTTATGTTTTGAGCCTTGTG*AGG*GTTGGGAGAGGCGGCGTTTG
CTTTTGCCCAGAAATAATGGCATTATTATTGGTTTGAGTGAGGAGGTGTGCTTTTCCAGATACAGTTTTGT*CTCGTTTGTTCTGCcatgtctgaaatcc
ttcgcaagctgttgctcatatttgtgcgtgttttgttaatgatcctggtcgtacatgattgtttgtccctgaagttttctttcgaggggtgtacaagtag
gcttatgtcacaaaacatgtcatcagaaatttcttttgaatgaattcaatg
page-top