Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9444  (registered. 2012)
Contig Information
Length 1246 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222631494|gb|EEE63626.1|| hypothetical protein OsJ_18443 [Oryza sativa Japonica Group]
Score 614
Evalue 8.00E-174
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9444
TTTTTTTTTTGATCTACTCCACGAGGATCCAAATGAATAACAAAACGGCTACAATGCCTAACTGTCCACATCTCAAGACATACTACTACACATACCGCAA
AAAAGGCTAGGCAGACAATACAAGCATTACAACATTCTGGCGGGGGTTTTAGCTAGCACCCTAACAACTCCTGTACATGTTCTTCATCTAGTTGTTACCA
CTACCTTGATCCTGCATGAGTGCATTCAGTCTCAGCTTCGAGTGCATTTCGGCAGTAGCATGGGAGAAGTCGGTCAGGGCACGGAACAGCTCCGGCAGGT
GCGCCCTCAGGATCGAAAGGGATTTCTCCCGAACTTGCTTCGACAGCTTGTTATGGGCCTCGACCTCGTTATCCAGCTTGCTTTTCAAGCTTTCCACGGC
AAATCTCTTCTCCGAGATCGCATCCTTCTGGCTTGTCCCCTCACCGCTCTCCGGGTCATCAAATGTCCTGCGCTGTCCATGTTTGTGATACCACTCCTCA
AACGCCCGAGCCTTGCGCACGTATTCCTTGTGGATTTGTTCACAGGCCTCCTTTTTCTTCAACTCCTCGTCTTGAACACCTAGTATGGTTTCCAGGACCG
CCCGGAAGCTAACGATGGCATGCCTGGCAAGGTCATCGGGCAGCTTGGCTAGTTGCTCATTCCATGCTTGGAGGAGAGCCTTCACAGGAGGTTGCTGCAC
CCTTGGTGGCGATGCTACTTTCTCCTTTAAGCTGCTCTCTATAGGTATAAGGTTCAATTTCAACCAGCTGTAGAGAGCATTTATGTACTCCTTCTGATAG
CTCATGAGATCACTGAAGTTTGTGTTCCACTTGTCTACAATATCATGCAGCTGACGCGTGTGGCTGTGGTGATGCGCACTTGTTTCAATGCTGGAATCAG
AAATGTCAACCGACTTGAGATCCAACACAGTTTTCAGCTGGTTTGCATGATGCATGTGCATATCTTCCCACATTTTTGCCAGCCTATCAGCAAGGTCCAG
AAGTTTTGGATAAAGTTGATTATCACGGAGATGCTGAATCTCTGAGACAGTTGAATCCATTGATTGCATATCAACTATGTATCTTGTATGCAAATGGGTA
ACAGCAGCTTTAGTTTTCTCCAGAACCTCAACAGCAGCATTGTTTCTCTTTTGTCTATTTAACAAAGCAACCTTCCGCTGATACTCAAGCTTCATAATCT
CACCAGCCTTCACTTCGTCATACAGCTTTTTCTCCCAGGCTAAAAT
page-top