Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15579  (registered. 2007)
Contig Information
Length 837 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 7
Wh_dL Crown of seedling 4
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L9 [Zea mays] >gi|195624144|gb|ACG33902.1| 60S ribosomal protein L9 [Zea mays]
Score 858
Evalue 3.446e-90
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15579
catagataacaagaggtctTatnagCAGGTAAAGACAGCATCTCCAAG*CTCCAGTTCCATGACATCCCTGATACATCGATCCGGTACAAAACTACAGCA
AACTTTTCGTTGATTCACTCAAGCCAAACAAAAAGAAGAAGAAGAAACAGCTTGTAAATCTTGGTTTCGACAAGCTCCAAGAACTCTAGGACAGTTTCTG
CTACCAGCTACAAAGGGGCTGCGGATGGATAGGTCACCACAACACTACTCTTCCTTGATGGCGCCC*TTGTCGCTGACGTAGATGCCGTCCAGGAACTTC
CTGATGTCCTTGTTCTTCACGTGGCATTTCTGGTTGATCAGGGCAGCAGAGCGAGAGACTAGCTCGATGTCGTTGCCATCCAGGACAATCTCATCCTTAA
CTTTCTCGGACCGCAGGATCGTCACACCGTCAAGCATGTCTACTTTCCTTACCTTCTTCTCGCCGAGGAAGTTCCTGATCTCGATGCCCTTGTTGGCGGC
GGTGATGGAGGCGTTGATGGGGAAGTGGGCGTAGACGAAGCGCATCTTGTAGCGGAAGCCCTTGGTGACCCCGGTGATGAGGTTCT*GGACGTGGGAGAT
GGCGGTGCGGATGGCGGCCATGGTCTT*GCGGGTGCCGAACCAGGCGTCCACCTTGAGCCTCCGCCCGCCCTCCTGCAGCTGGAAGTCGAGGTTGAGGTG
CTTGAAGTTGCGGGTCAGCGTGCCCCGGGGACCCGTCACCGAGATCATCTTCGCCGACACCTTCACCGTCACCTCCT*CCGGGATCTCCATCGTCTCCGA
CGCCAGGATCGTCTTCATCTTCGCacgccgggtttgc
page-top