Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15577  (registered. 2007)
Contig Information
Length 798 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 7
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit translation initiation factor eIF1 [synthetic construct]
Score 474
Evalue 8.77545e-55
Total Hit Count 310
Registered year 2007
Contig Sequence     [ Download ]
>Contig15577
ataAACCAT*ACTGCCATACTGGTGGCACATACAAACCATGGTGAAGG*ACAACTTGCAT*CAACACACC**GATG**CAAATTCAAATGTCTCGGATGT
AAAAGTGCATCAAACACAGATGCCTCACGTGAC*TACTAGCAATTCAAA*TGGTCTTAGATGTGACAATACCAAGTATACGACAACTTCCAGGCTTCGGT
GACAGCACACGA*G*CATTTGTGTGTTGCCTAAAATCCGTGAATCTTGATGCTCTCTTTCTTTGCAAGTCCAGCCTGAACTAGGAAAGTAGCAACATTTT
TACGCTGATCACCTTGGAGTTGGATGACCTGGCCTAGTTCTGGATCCTGGACTACA*GTACCATTACAGCAGAATTCCTTTTTGAGATCCTTGAGAATCT
TGTTGTAGCTGTAATCTTTCTTCAAGCCCTGAACAGTAGTCAGACTCTTTCTTCCGTTGCGCTGCTGGACACGCACATGCACATAGTTCTTTGATCCAGC
ACCAGCGCCCGGAGTCCTCAGCATTTGCCTCAGCAAACGGATCAAAA*GCAGTTGGAACCT*GG*ACGTCGAGATCAGACATGAACTTGTTGTTTGGTTT
GATTGGCCCC*AAACAAACGAGGCTCTATTTATTGTCTTG*ATGTGTGAGCTTG*TTCGGTGGAGAGAACCGCGGACGGCGAATGGGGGAGGAGCGGGGG
AGGAGGAGAAACGCAGCACGGGACGAGACGACTTGTCCTcgg*ca*cgGGGGAAATATCTGtctcctctcctctctncctcgtgccgaattncctgca
page-top