Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15575  (registered. 2007)
Contig Information
Length 774 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_SL Seed DPA30 6
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 4
Wh_r Root 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0667600 [Oryza sativa (japonica cultivar-group)] >gi|52075823|dbj|BAD45431.1| putative glycine decarboxylase complex H-protein [Oryza sativa Japonica Group] >gi|52076539|dbj|BAD45416.1| putative glycine decarboxylase complex H-protein [Oryza sativa Japonica Group] >gi|113596355|dbj|BAF20229.1| Os06g0667600 [Oryza sativa (japonica cultivar-group)] >gi|215701162|dbj|BAG92586.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765054|dbj|BAG86751.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218198716|gb|EEC81143.1| hypothetical protein OsI_24045 [Oryza sativa Indica Group]
Score 651
Evalue 3.00225e-66
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15575
gaacagagcttaaatcagagatgaaaccatggcaacaagaaAAAGGAACTCGAGTGATACACATATTTCGG*ATCTCACAAGCCCTTGTAGGGTAGGCAA
ATGCCATTTATTCCATGTTTTGAT*CCTTTCTGGGCTGAG*AAAGCAGGTGGTACAAAGTGCCCAACAGCACATGACAAACACCTACGAATGTCGAAGCG
CAGATTCTCTTTCAGAAGCCACCATGCTTAATGCTTGCTGTCCTCTTCCTCGCAG*AATTTTGAGTACTTCTTGTCATCCATCAGTGAATTGAGCTCACC
TGCATCGCTGACCTTGACCTTGATGATCCAGCCGCCCTCATATGGATCTCCATTGACCAATGCTGGTTTCTCTAGTAGTTCATCATTCACTGCAATGACC
TCTCCAGACACCGGCGAGTTGATGTCACTGGTTGCCTTCACACTTTCAACAGCACCAAAGTTCGTTCCCTGGGATACAGAGGCGCCAACTTCTGGCAGCT
CCACATACACAACATCACCCAAATGGTCCTGGGCATGGTCTGTAATCCCAACGGTTGCGGAATCACCATCAACCTTCACCCATTCATGGGTTTCAGCATA
CTTCAGATCCTTCAGCACGGTGGAGAAGGCCCTGGGGAAGGCGGAGATCTTGAGGTAGGAGGCGGCGCGGGAGGCCCAGAGCGATCTGGAGGCGGCCATG
GCCATGATCACGCGACGGGGGGAGGAGGAGGGGGATCGCTCGGCGCCGCCTCCTCTGTTTCTCTCTCTCTCtcc
page-top