Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9443  (registered. 2012)
Contig Information
Length 1159 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|77556661|gb|ABA99457.1|| adenosine 5'-phosphosulfate reductase 6, putative, expressed [Oryza"
Score 400
Evalue 2.00E-109
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9443
ATTAGTACAAGACAGATGAACATACTGCAATTGCAGATTACATGTGAAAAATAGTACAAGGGCTTATGATGTGTGCCCAGTTGCTCAAAAACTATGACAA
TTGGTACTCATGATTAATGTTACAGTGTGGTCTACACAGGCTCAACAGTATCCCTAAGATTTACAGGCTACAAACAAGATGTTTCACTACATGTTCATGT
GAGTTACAGGAGCTTCCACATCCAGCGCAATTCAAACAGCCCGCATGCTCTCCCGCTCGACGTTAAAATCCAAACCATCAATCCAATGTAGCAGCTCGGG
GGGAAGATTGCCCACCAAGAGACACGGAAGCTAGAGATGATGCCCAGACTCTCATGTTTATGGCTCCAACCATGAGCCTCCATTTGCTCCACATCTTCCT
TACATCCACGGCATGGGGCACACATTCGAGCAGCTGGGTCAATTTGGCAAGGACTCCAAAGTTGGCATGCCGGAAGTATTGGGCCCACAAGCCTTTGATG
CAGGCGAAGAACTTTGGGAAGAAGAACAAGAATATCCTCAGGCAAATAAAGAGGATGCTGAATGCTAGGTAGGGCTCGCTCTTCACTGATTCGCTGACTG
AACCACTCCAAAGCTTCGCATACTGTGTGCTTCTTTCGGTTGTGTTCCCCTTCCGTGGACCAAGATATGCAACTGGTTCTTGTCCAGTAACAGCAGAGTA
GAAGTTGACCAGTGAGTTGAGATCTTTGGCAACAAGAGGCCAAAATGCATATGACTCATGTGCTATTAGTATAGAAGGAAGGCTGCGGACACCATATCTT
GATAAAACTGTTGGCATCACGTTGGACTGTTCTACAGCCAAGTGCTTAATATGTGGATACATTGAGCTAAGATCGTCGAAGATTGGTCTCATTCTATGAG
AGAAAGGGCACCATGATGCATAGAAGAGGACAGCAGTGTACTCCTTTCCACCCAACTCTCTGATAAGTTCCTCCCCATTAACCTCCTCGGCCGGGTGCCC
CTCCGTCGCGGTGCGGCAGGTTCGCCGGAGCCCCTGGAGGAACGGCGGCGGCCTCTCCTCCGGCCTTCGGCACCGACCAGAGTGTGCCGCCGCGAGCGGG
TACGCNNNCACCTGGGACGGCACGGGGAGCTGGAGGAGCACAAGGAGGAGGAGAGGGGC
page-top