Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9442  (registered. 2012)
Contig Information
Length 1161 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig9442
TTTTTTTTTTGACCTAATCAATTTAAATGAGAAGTGCAGATTATCAAAACATAACACATAACAGAACAAGTTGGCGTATCCANCTAAGTTTCGTACCTTC
AATAGTATCATGCAGAAGACAGCTTAAGTACAAACTGGTTCTACATCCCAGATCAGAGAAGCTCAAAACGCAGCTAAACCAGTTGCACAATATTCATTGA
ACAGAAAACAGTTCAGGCCTACGCAGAGGCACTGTCACTCACGCTAGCAACATATTCACTTCACGGCTGCGGTGGCCGAGGAGATGTCGCCCTTGGGACT
GGAGTGGGAGTGGTGGCTGTGAAGGTTTCGCCCTTGACGCCTGGAATACCAGGGAAACTGACGAGTCCCGAATCGCCAACGAAGTTTGGGAGTCCTCCGC
CACATCTAGAGCATCTCTGCGGCCAGGGAATGCCACATGGGCAAGCCCTGCTCTCCACCACCTCAACCCGAGGATCTATACCGCTAAGATCGCCCTTCAA
AATCTTTGCATAATCTGCCATTTTGAGAGCATAGAAAACTGGGACCATGCCAAATAAGTAACTCCACTTGGCCCAGTTGGAGGTGATATCCTTGTACCAA
GTTTCCACGGTGGATGGTGCCATCAACAGTTCTAACAGCTTCTTTGCGAGCGGCTTTTCATCCTTCTTATCACTCTTACCACCCTTCTTGTCACTCTCAT
TGCCCTTCTTGTCACACTCATTGTCCTTCTTGCCACTCTTATTGCCCTTGTTGTCATTGCCACTCCCATCACCCTCCTTGTCACTGCCAGCCTCAAGCCT
AGCAAGTTCCTTTTCATGAATGGATCGAATGGTATCCATCCAGACCTCATATCCATGTTGCTTGTTAGCTTCCCTGACCTTGTCCACATCTTCAAGGAGC
CTCTTATTCTCAGCAGCGAGGTTCTCCGCTCTCTCGGTAACTTCACTCAGCTTCTCCTTTAGATCGTGTATGATCTCAGATGTTTGCCCATCTTTATCAT
CATTTTTCTCTCCCTCGGACATCATCACCAAGCCCGCGACGACAGCACCACCGCCCAGGATATGATAAATATCCTCTGGGCGCAGCTTAGGCAGATGGTC
AACAGGAATAAATGCAGATTCGCTCAGCTTCGTGCCAGCTTCACGGAGCGTCTCCCCGAAG
page-top