Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15533  (registered. 2007)
Contig Information
Length 754 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 7
Wh_h Spike at heading date 8
Wh_oh Pistil at heading date 2
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100193844 [Zea mays] >gi|194694272|gb|ACF81220.1| unknown [Zea mays] >gi|195608562|gb|ACG26111.1| NADH-ubiquinone oxidoreductase 18 kDa subunit [Zea mays]
Score 694
Evalue 3.77521e-76
Total Hit Count 285
Registered year 2007
Contig Sequence     [ Download ]
>Contig15533
cattttaccctgtaaaaaagggagttaacaaacaTTTTGATGAGATGAGCGACAGGTTCAGTTGCAATGCGTGCTTATTACACGTTTGATGGAGACATGT
TCTAGCTCATATTGCACGACAGGTATTGAACAAAGTGAAATCAGCACGAGCGGCAGAGGAAAACAACATCTTATGAAAATCTCCAGACAACATACAAATC
CACAGCTTAGGCTGCTTCCTCCGTCTTCGGGGGGCCCTTCCACTTGAAGTTCTCTGCGTACGTTTTGGGCTTCAGAAGAGGTGTATGGCGCTTCCTAACC
ACATATTCCCATCCGTGTTTTTCAGCAAATGCCTTCGCTGATTCGGCACTGTCAAACGTAAGTCCAGCTTCACCAACATTAGCATACGGATCACCAGTCG
ATGTCCATCCCATCAATGGGTTCTCCCACTTTTGGGTTGACACGAAATTGATTTTCCACCTCCCGACTTTGCCAGAACCTTGCTGAGATGCAGTCCTAGC
TGGTGAATAGATCAGAACCTTGCGGCGGAGGTGCTCCTCGGGGATCCCGGAGACCATGCCGATCTCCCCGGGCTTGATCTCCACGAGGGCATCGGAGGCC
TCCGCGGAGAGCATCCGTGCCCGGCGTAGGCGAGAGCAGGGCCCGGCCGAGGGAGGGGAAGACCCGCCGGAGTGGGGCGGCCAT*CGCGTCGG*AGCC*G
TGCGCCGGAGAGAGGTGGGGGCAAAAGGagagagatgcgggggaggagcttcgc
page-top