Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15523  (registered. 2007)
Contig Information
Length 1484 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 6
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0498700 [Oryza sativa (japonica cultivar-group)] >gi|48475219|gb|AAT44288.1| putative B2 protein [Oryza sativa (japonica cultivar-group)] >gi|51038049|gb|AAT93853.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579502|dbj|BAF17865.1| Os05g0498700 [Oryza sativa (japonica cultivar-group)] >gi|218197041|gb|EEC79468.1| hypothetical protein OsI_20486 [Oryza sativa Indica Group]
Score 1358
Evalue 8.65223e-148
Total Hit Count 109
Registered year 2007
Contig Sequence     [ Download ]
>Contig15523
agGTAAGGTACAGAGACAACAGATACACTCCCAGCATCAACCGCCCTCACTTTGGGGCATTCATGATGCATCACAACAGTATCCCCCGTCTTTCGGGGTT
TCCCCGCTGGCGGCGGGCATACTGCACTACAAATACATAAATATGAAAAACATACACATCACCGAGATTACGGACAGACGGCACCGACACAGACAGGCTC
ACATCTTTAGAGGCCTACTTCTTCCAAGCACCAGGTCCTTTCTGGGGGAAATGCACCACCAACCAACAGCTTGCGCTTTCATGGACGACGGACGGAACAG
ATCATTGTGAAAACATCTTCCACAACTTACAGGGATGATATTTACTAAAAAGAACCACAGAGCAACCACAACCATGTTCCAAAGCAGATCAGGCGTCTTC
CGTCTTGCACAGGTCCAGCAGTGACAGTGTCTCTGCTATGGAGAGCTCGAGGCGGAATTTAGGACCATCATAG*TGGTGCAGCACTGGCCTAAAAGCATC
CTCTTCCAAGGCCTTGCAAAGCCTTCTAATGCGGATCCTCACCTGTGCTGGGAATCTGGATTCACCTTTGCACTTCTTATCTTCCCAAGCGGTGGGATCA
ATGTTTGATCCTCCAAAACTAGCAGCCTCAAACACCCCATGTAGCTGATGGGTCGTGTAGTTGTAGAGGAAAagaggtagaccaggagtgatggctcgga
ctgaatcacgatatcttgctggcaAGCCAAAAAGCTGTCTCTTGAGATCCTCCTGCATGGTATCATTGTTGCAGACAAAGATGTATCCACCAAGAACTTC
ATTCCTTGGTAGCATCTCGCTTGTTGGTAATGTTTTGAAGCGCTTGTCAACAGAGTTGTTGTTGCTGTTGCCTCCATTGTTGTTGTTACCACCATTGTGT
TTGCCGTTTGCTTCCTTCCCATTCTGATTATTCGGATATTTGTTGACCCCGACATTCATCTTGAATGAATTGACATTACCGTTGTTTCCCTTGGGGTACA
TGGGGTTCATGTTATAGGCCATGTTGCGGAAAGGGTACTTCATGGCAGCCTCGTTCATCTTGAGATCGTTCATCTTAAGATCCAGGTTCATGAGGCCAAG
ATTGAGGTGGTCCATC*TTGTTGTCTTCTTGGTGGTAGGATTGCTTATCCCATTGCTTCACATCAGGGACGGTGTTCATCCTTGCATACTCAAAGTCATT
CATCCTCTCAGCCTTTGACTTTGTGATCTCAGCCAGCTTTGATGTCATGAGAGACCATTGGCGGTCCTCCACCACCTTTGATTGCCCACGGAACTCATCT
CCGAGATGCCACAAGTTGTCCATAGCTCAGTTCAAGCTCTCTGCTCGATTCGGCGCCGGATTCCGGCGGGGAGGGCGCTGGATTTGGGGGCGAATCGGGA
ACGAACTGCTGCGAGGAGGAGAGGAGTCGGCTCGGCTGGCTTGGCGTTGGCTCCCACTTCGCTCCGCCCACACGGagtccaccc
page-top