Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15491  (registered. 2007)
Contig Information
Length 1117 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_f Spike at flowering date 8
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 3
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit aspartic proteinase [Triticum aestivum]
Score 1461
Evalue 6.63685e-160
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15491
tttttttttTAGAAGGCAAACGTTGTTTAT*CACATAATAATTCAACATCTTCGGGGCAAACGTCCACAAACAGTCTTGCCATCTTAGGAACAACCCTTG
GTCATGTCAGGGTCTTTGAAAAGCAGCATGTAGCATATATATACACACACAGCACCGGTCAAATTCGGAGTAAAAAAGCTAAGCTCTCTCCCGGCGCAAG
TGTTCGCCTCCGCGGTGGGGCGCTCGCTCGACCACCCTTTCAGGCCGCCTTGGCGAATCCGACACGCAGCTTGCCGTAGTCGAAGACGGTGTGGTAGGGG
CCCATGAAAACGTCTCCCAGGATCCAGAGAGGACCGCGAGGAGGCGGGATGTCCATGGCTGTGAATCCACTGATGCACTGGGCAGCAGCTCCTTCGCCAA
CCTTCAGGATATACTCTTCTGGTTTCAGCGCAAACTTCTTGCCACTAATGGTGAACTCAATGTCAGGCATGGATCCAAGGCTGGCACAGTCCACAGCTGA
TTCTCCCATGGGGCTTGGCAGACGGTTGCACAGCTGGTTAACGTAATCTAGTATGAGATCCTGGGTCTTGTTCTGTGCAAGTTGGTTCTGCATCCACACA
ACAGCCATCTCACAGGCACTGCACATGGGATCGGTATGGAGGCCATTCGATTTCACAGGCTCATCATCGACCACGCTCCGAATTCCAGCACTAACACCAC
GAGTCCCATCAAAGGTGCACAGACCAACCTGGGAGCAGACCTTTTTGGGCTGTGTCTCTGCTAGCAACAGGTCGAGGATCTGTTGTCCATACTGAGAAAC
AATTGTTTTGCACTCTTGGCTGACTACCCCAGCCGCACCAATCTTCTCGTTAATTTCAGTAATGATGGCCGTGGGACCAGCAAGCAATGAAGTTCCAGAA
TCAGCAATTGCAGCACAACCGCCAGCACAGAATCCTGTGGACTTCCCTCCAACCAGGACATcacccaTGTCAAACTGCCAATATCCcttctgGGTGACTG
GGACATATGTGTGTTCACCCACGTAGTGTTTAGGATCCATTCCTCCAAAAataatttcaccaccctctccttcatcatcagcatgtcggttcaaccagaa
cgagaaaacaggatcac
page-top