Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9433  (registered. 2012)
Contig Information
Length 922 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242081753|ref|XP_002445645.1|| hypothetical protein SORBIDRAFT_07g023320 [Sorghum bicolor]
Score 267
Evalue 2.00E-78
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9433
TCAGAAATGCACAATGTTGTTACAGACATGTCACATGTTAGGTTAACTCCTCTCTCCCAGCCTAAAGATCGGTGTCTATCAAGGATGAGCACATTGACAA
ACGACAAGGTACATGGAGGAATCAAGCCATAGCAGAAATCCTCTTGTACAAAGGAGCAAAAGTTAAAACACAAGACAAAATTTCATTGAAATAAGCTGGC
AACCCTTAAAATGATGAGGTCCAACAGAAAGCACAAAGATAAGAGTTATGTTGGAATTTCAACAAGCCCAGTCCACATGTTATGGAATTCACCCAAGTAT
GGATGATGAGATTCCAGAGGGACAAATAAGTATTATTGCATGTTCTAGTAAAAGAACTTGGACTTTCGCCGTTATCTAGTATCCCCAGTAATCATTACGG
ATCTCATCATCAAACTTCTTCTTGAGTTCAGGGTGCTTCGCGAAGTACTCGTCTGCTGTCATTGTGCTGATCTTTTTCTTCATCTCTTTCAATTCAGCAA
TCTCCTTCTCTATCCTCTCTGATTCCTTCAGAGATGTCTTCTCTGCTTCCTTCATTTCGATTAACAGAGCATCAAACTTTGGCTTGTACTCAGGAGTGAC
AGTGTCAACATACTTTGGGATCTCAATGCTATCATAAGCCTCCTTGTACATATCCACAACTTTCGATCCGATTCCCTTTTTGTAGTATTCCCAGTCAATT
GGCTTTGGTTCCTGGGAGAACTTGGTCTGGAGCTGGTGGTTGACGTCCTCGAAGGTGCGGCGGAGGTTGGCGAACTCCTTCCGGGCCTGTCGGAGACGAG
CATCTTGGCCAGGCCGTCCCAGTCGATCGCCTTCCCGGCCTTGGCCGCAACGTCCGTCACCTTCTTCACCCCGCTCATCTTCGNCTCTGGATCTGCTAAA
CTTGCTAGGGCTGTGATCAGGG
page-top