Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15469  (registered. 2007)
Contig Information
Length 941 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 8
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit beta tubulin 6 [Hordeum vulgare subsp. vulgare]
Score 1112
Evalue 1.46874e-119
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15469
aaagCATTCTACTGTATTTCAAATCC*CTTGCTTGAAACCTCACATAGAATAAATAATTCAAGCAAAGAAACATAGCATCGAGTGAACATGCCTACATAC
GAACGCAGTACAAATCCAATACATGCCAAG*ACACGCAAACAAGCAGCAGAGTTGTAGCCATGGTACTCTCTAGTCTCTACTAGTAACAAGCTCCAGTTG
TACGAAAACCACAATACCACATAAACGGAGAGATGAATTTGTCACCGATCTTACTCCTGCTCCAGGTCTTCCTCTTCC*TCGTACTCGCCCTCCTCGTCG
GCAGTGGCGTCCTGGTACTGCTGGTACTCAGAGACAAGGTCGTTCATGTTGCTCTCGGCCTCAGTGAACTCCATCTCGTCCATCCCCTCGCCAGTGTACC
AATGCAAGAAAGCCTTCCTCCTGAACATGGCCGTGAACTGCTCGCTCACACGCCTGAACATCTCCTGGATGGAGGTGGAGTTGCCAATGAAGGTGGACGC
CATGGAGAGGCC*GCGTGGTGGGATGTCACACACGCTTGACTTGACGTTGTTCGGGATCCACTCCACGAAGTAGG*AGGAGTT*CTTGTTCT*GCACGTT
GATCATCTGCTCGTCAACCTCCTTGGTGCTCATCTTGCCACGGAACATGGCCGAGGCTGTGAGGTAGCGGCCATGGCGCGGGTCAGCAGCACACATCATG
TTCTTT*GAGTCCCACATCTGCTGTGTGAGCTCAGGGACAGTGAGGG*A*GCGGTACATCTGTGACCCACGAGATGTGAGCGGCGCAAAGCCcaccatga
agaagtggaggcgcgggaaggggatcaggttgacggcgagcttgcggaggtctgagttcagctgtcctgggaagcgaaggcagcaggtgacaccgctcat
ggtggcactgatcaagtggttcaggtcaccaaagctaggtg
page-top