Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15462  (registered. 2007)
Contig Information
Length 767 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_e Seed DPA10 9
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ppkA-related protein [Pseudomonas fluorescens Pf-5] >gi|68347660|gb|AAY95266.1| ppkA-related protein [Pseudomonas fluorescens Pf-5]
Score 94
Evalue 0.114347
Total Hit Count 44
Registered year 2007
Contig Sequence     [ Download ]
>Contig15462
aggaattcggcacgaggcccctttccccttcttctcgGTGGAGGCGAACGACGAACCC*TAACCGCGCGAGGAATAAGGAACGCCCA*GATCCGCAAGGA
CGGCGACGATGGCGGCGGTTCGGTGCGCGGCGAGGAGCTTCGGTGGCTCACTGCTCCAGCGAACGCAGGCGGCGGTCGCGGATGAGGGACGCCCGCTCGT
GCCAAGCAGGTTCATGCGCTCCCGCCAGCTCTCCACCAAGCATGCTGGCAAGATCCAGAAGGAACTGGAGCCGTCTGAAGTGGAAGCTAAGTTGAAGCTG
ACGAGGGCGAAGCTGGGTGCAACGTTAGATAAGTTGGAGAAGGAACAGCCAGATGAGTTTATGTTGCGCTTGAAATCCATCGGACGTGCGGCTGACGGTG
TGGTCAATGGAGTTGTCAAGTTGGCAGCTTTCTGTATGGTTACTGCTGTTGCTTTTGGTGGCGAAG*GGGTAGAAGCACAGGCTGTTACCAAGGGAAGCC
AGTGAAGACAAGATGGAACAATGAGAACCAAAGATGGCCCAGC*TTGTTTTAAGTTCAATTATGACCTCTGCAGTTTGGCTATCA*TGTTATTATATCTG
TATCTGTCTATCTAGTCGAGTACTGTAGCTTGATCCGAACATACTTGCATAGCTGGTATGGTCACTGGCATGCATGGTTGGTGTTATTGGCTTCTGTCTT
GAAGTGATTGCaatcaacttataagtgttcactttctaaactaattgtgtgacgtncttgtacagat
page-top