Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15421  (registered. 2007)
Contig Information
Length 2244 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 7
Wh_oh Pistil at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit beta-D-glucan exohydrolase, isoenzyme ExoII >gi|1588407|prf||2208395A beta-D-glucan exohydrolase
Score 2801
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15421
cgtccgccagtgccagcgccctctcgtctctgcTGTGGTCCGCTGCCCag*AGCCTCACTATCCCCGGCCTCTCGCCGCACGCAGCGCGGCCGCACCGGC
GTCCTCGTCGTCCCGTCGTCCCGTCGTCCGTCACCGCGGTAACTGACTGGTCTATACATATAGTCGGCGGTGATCGATACCAGACGCAGTGCCAAGATGG
GGAGTCTGCACAAGACCACCTTTGTTCTCCTCATGTTCTGCTTGGCGGCGTTGGGAAGCGCGGATTATCTCAAGTACAAGGATCCGAAGCAGC*CTCTTG
GCGTTCGCATCAAGgcaTCTGCTTGGTCGGATGACCCTCGCTGAAAAGATCGGCCAGATGACCCAG*ATTGAGAGGGAGAATGCCACAGCAGAGGCCATG
TCCAAGTACTTCATAGGTAGCGTACTGAGTGGTGGAGGCAGTGTGCCTTCTCCTCAGGCATCCGCTGCGGCTTGGCAGTCGATGGTGAACGAGATGCAAA
AGGGCGCCCTTTCCACCCGCCTAGGTATTCCGATGATCTACGGTATTGATGCCGTGCATGGTCACAACAACGTCTACAAAGCTACCATCTTCCCACATAA
TGTTGGCCTCGGAGCTACCAGGGACCCTATGTTGATAAAGAGGATAGGAGAAGCAACTGCTCTTGAAGTTAGAGCAACGGGAATTCCTTACGCTTTTGCT
CCGTGTATTGCGGTGTGTAGAGATCCAAGATGGGGACGCTGCTACGAAAGCTACAGCGAAGACCCAAAGGTTGTCCAGTCCATGACCACACTTATCTCTG
GTCTGCAAGGCGACGTTCCGGCTGGTTCTGAGGGAAGGCCATACGTTGGTGGAAGCAAGAAGGTTGCTGCATGCGCAAAGCACTATGTCGGTGACGGTGG
TACGTTTATGGGGATCAACGAGAATGATACAATCATCGACGCCCATGGGCTGATGACTATCCATATGCCTGCTTATTACAATTCTATCATCAGAGGTGTC
TCCACTGTTATGACCTCGTACTCTAGCTGGAACGGCAAGAAAATGCACGCCAACCACTTCCTTGTCACTGATTTTCTGAAGAACAAGCTCAAATTCCGGG
GTTTCGTGATTTCAGACTGGCAAGGCATTGATCGGATTACTagtcctccaggtgtGAACTATTCTTATTCAGTTGAGgccggaGTTGGTGCCGGTATTGA
CATGATCATGGTTCcttttgCCTACaccgaATTCATTGATGATCTGACATACCAAgtaaagAACAACATTATCCCCATGAG*CAGAATCGATGATGCTGT
CTACAGGATTCTTAGGGTGAAGTTCACCATGGGCCTGTTTGAGAGCCCCTATGCTGACCCAAGCCTCGTTGGTGAACTCGGGAAGCAGGAACACCGCGAT
CTCGCTCGTGAAgcCGTCAGGAAGTCATTGGtgttgCTGAAAAATGGAAAATCTGCCtccgctccgctgttgcctctcccgaagaaggccggcAAGATCC
TCGTCGCCGGAAGCCACGCCGACGACTTGGGCAACCAGTGCGGAGGATGGACCATCACATGGCAAGGACAGACCGG*CAACGACAAAACTGCCGGGACGA
CGATCCTTTCGGCGATCAAGTCCATCGTCGACCCCAGCACGGAGGTGGTCTTCTCGGAGAACCCGGACAGCGCCGCCGTGGACAGCGGCAAGTACGACTA
CGCCATCGTGGTGGTCGGCGAGCCGCCCTACGCCGAGACGTTCGGCGACAACCTCAACCTGACGATCCCTGCCCCGGGTCCCTCGGTGATCCAGAGCGTG
TGCAAGAGCGTCAGGTGCGTGGTGGTGCTCATCTCCGGCAGGCCGCTGGTGGTGGAGCCGTACATCGGCGCCATGGACGCGTTCGTCGCCGCGTGGCTGC
CCGGCTCCGAGGGCCAGGGCGTCACCGACGTGCTGTTCGGCGACTACGGGTTCTCCGGGAAGCTGGCCAGGACGTGGTTCAAGTCGGTGGACCAGCTGCC
GATGAACGTCGGCGACAAGCACTACGACCCGCTGTTCCCCTTCGGGTTTGGCCTCACCACTGAGGCCAACAAGTGAGTCGGCTGAGATAACTGAGATGGG
ATGTATCTCGGTTGGGCTGGAGAGATGGGACACATACATACATTGCGTTTtgtggttgatttgttagcaataaaagagcgatgcgttcttacagatccgg
tggtgttacagcaagccgtccgatcgccataataatcgtcgtta
page-top