Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15417  (registered. 2007)
Contig Information
Length 1440 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0815200 [Oryza sativa (japonica cultivar-group)] >gi|75294984|sp|Q75HE6|MTHR_ORYSJ RecName: Full=Probable methylenetetrahydrofolate reductase >gi|40786561|gb|AAR89836.1| putative methylenetetrahydrofolate reductase [Oryza sativa (japonica cultivar-group)] >gi|108711742|gb|ABF99537.1| Methylenetetrahydrofolate reductase, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113550154|dbj|BAF13597.1| Os03g0815200 [Oryza sativa (japonica cultivar-group)] >gi|125546191|gb|EAY92330.1| hypothetical protein OsI_14054 [Oryza sativa Indica Group] >gi|125588378|gb|EAZ29042.1| hypothetical protein OsJ_012525 [Oryza sativa (japonica cultivar-group)]
Score 897
Evalue 2.04503e-126
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15417
cccgcCGCGACGCCATTAGCAGAGCCagnagcaGTGGGGGAGAAGGTTCTAG*AGGAAGAGGAAG*AGGAAG*ATGAAGGTGATCGAGAAGATCCAGGAG
GCGGCGGCGAATGGCCGGACCGTCTTCTCCTTCGAGTACTTCCCGCCCAAGACGGAGGAGGGCGTGGAGAACCTCTTCGAGCGGATGGACCGCATGGT*G
GCGCACGGCCCCAACTTCTGCGACATCACCTGGGGCGCCGGCGGATCCACCGCCGACGTCACCCTCGACATCGCCAACCGCATGCAGAACATGGTATGTG
TGGAAACGATGATGCACTTGACATGCACCAACATGCCAGTGGAGAAGATCGATAATGCTTTGGATACCATCAAGTCCAATGGGATTCAAAATGTTCTGGC
ACTTCGAGGAGATCCTCCACATGGCCAGGACAAATTTGTTCAAGTTGCTGGTGGATTTTCTTGTGCTCTAGATCTGGTGGAGCACATTAAAGCCAAGTAT
GGTGATTACTTTGGCATAACTGTCGCTGGCTATCCAGAGGCACACCCT*GAGGTAATACTAGGCGAGGAAGGTGCTACGGAGGAAGCATATAGCAAAGAT
CTTGCTTACTTGAAGAGAAAGGTTGATGCTGGTGCTTGACGTTATAGTCACCCAGCTTTTCTATGATACCGATATCTTTCTCAAGTTTGTGAACGAC*TG
CCGTCAGATTGGTATAACCTGCCCTATCGTTCCTGGCATAATGCCAATAAATAACTACAAAGGATTTGTGCGCATGACTGGATTCTGCAAAACTAAGATT
CCAGCTGAGATTACTGCtgccattggattcattaaacgggaggtcaatatggttggcttttgcactgtggactttgccaagggttccccagatgcgattt
tgcttgataaagcttgcttggtcctgtgggaTGAAGCTCCAATGGTGCGCTGTCACTGTTtcgaagCTCTTGATAGAATTTTCAGAGATATACTTGCAGT
ATATGATAGCTCAAGGTCACTCTTCCCTTTAAGAGGAAAGGTtgttgttgttagtggcgattttaagcaagtacttcctgttatgcaagaaggtgctaag
actggaattattggagcttctctggtcatgtcacctttatggaggcatatcaagctctacgtgatgtctgcaaggattgagaagacaattggtctgattg
ctttcggaagaggtggcagaaagaatagaaacaatgatgcctatgttgattcaaagtatagttattaagcaaaccattactgttattagttcttagttcc
acctatatgtttgagaaattcaaatgatggaatcaatggtctatatttcctttaatttgtggaatatatactgtgtaatcaatagtggactgggtgggtg
ctgccatcgtgctttgttgttttgtgtaacaggctgtatc
page-top