Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15374  (registered. 2007)
Contig Information
Length 1732 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 9
Wh_r Root 1
Wh_yd Spikelet at late flowering 5
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0645200 [Oryza sativa (japonica cultivar-group)] >gi|55295966|dbj|BAD68006.1| Na(+) dependent transporter-like [Oryza sativa Japonica Group] >gi|113533232|dbj|BAF05615.1| Os01g0645200 [Oryza sativa (japonica cultivar-group)] >gi|215697393|dbj|BAG91387.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218188749|gb|EEC71176.1| hypothetical protein OsI_03049 [Oryza sativa Indica Group]
Score 1692
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15374
acTGCTTTGTCTGAGAAGC*GCTTATTTATTTAGAAGATGAAAAATACATTACACACCAAACTTAATTGCAAAGCCTTGCCTAAATCATTAACAAGGGTC
CTTCCTACCAATAATCAATTATCTAGAATAAACAAACGTCCTTATCCTGTTTTTGTGTTTTACATACCTAAAATATGGGAATATAAAAAAATTCTCTGAC
GTAACCACGCTCAACTAAAACAGGGTAACGACTAGAAGCTGGAGCCTAGAATTGTTTTTGCTTCATTCATTCCTTGAAATCGTCCTTGTCATCTGCTGGA
AGGCCTCTGTTTCTCCAGAAAACTGCGAGAGCACTGCCTCCGAGCGCCATGCACACAACACTGACAGCAGAAGGAACAGCAACAAGAGGGTTTGTGAAAT
GCTTTTGCGCAAGTAAAAATCCAAGCGCAGAACTCTGCATCCCACACTCAATTGAGATGGTTCTAGAAGTTGATTCCCCGAAAGAAGACCATTTCGAGAT
CCAATAGCCAAGAGCGAATGCAACAGCATGCAGCAGAGCAACAGGGAGAATAAGTTGAGCACCTTGAGTTTTCAACACTTCAGCGACTTGCCCAATAGGG
CTAGCACAAAGCAAGGTGGTGAGGATGACCCCTATCAGTGGTGTTATGGAGATAATCCGCTCGGTAAACTTGGG*AAAATACT*CATGTGCCAACACTCC
AACGATAGTCGGTACTAAAACAACCTG*AAAAGTACTGATGGCCAAGCCTGCAGCATCAACAGGGACtaattgaccagcaaggagtttagtaaggagtgg
tgtcatcgctatagcaccaatagTCGAGCAAGTGGTCATAAGAACTGAAAGTGCCACATTTCCTTTGGATATGTAAGTTGCAACGTTTGATGCTTGACCA
CCAGGACAACATGAGACCAAAATAAGACCAGTTGCAAGAGGAGCAGATAGCTTCAATGTCAATGCAATAGCATATCCTAGCATTGGTTTGATCAAATACT
GCGCAAGAAATCCCACACCAACTGTCCATGGATTCCTTAAACATCTCCTGAAATCTTCAAATGTTAATGTTAGTCCCATTGACAACATTAGAAATCCTAG
GCCCACGGTAAAAAGATCAGTCTCCAACCAGGTGACCATTGATGGCTTGTAGATGCCAATAACTGTACCTAATATGACCCAGACAGGGAAAAGAGTGGTG
AGTAGCTCAACTATTTTCTCATACTGGCTTGCTCCAGTAGGCTCGCTCGCTGGCAGGTTACTAGAAATGTTAGCTTCTGCCTTGCAGAAAATTTGACGGC
TCCTCACAACGGGAACAAGAGTGGTCGCTGGTGAGGGCGCAATGGCCAATCCCCAGTCGGCCTTCTCCGTGGCAGCACTTCCATATGCTGGCACAGAGCA
CCCAACTCTCAGTCCGCACCCAAGACGAGGAGCGGCGAGACGCGGGCGCGGGCGGAGAGCGCGGGAGACGGATGCCATGGAGTGGAGAGGGCAGGTCGCG
GAAGGCGCCATGTCTGACAGAGATAGCGTGTGGAGTTCCGGAGGTGGTGGAAGGAGAGGAGTGAGGGTTTAAGACTCTTGAGAGTGAGCGGAGGAGAAGT
GGTGGCGCTGGCGTTGTCGTCGACGGGGAGAGCACCAGTGGGGACGAGAAAATCAGGGGGCGCCGCGAGAACCACACATCCGGCGGCTTGGCCGCGGCGc
gncctGTG*ATCAGGTCaggggctctctctcc
page-top