Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15360  (registered. 2007)
Contig Information
Length 1092 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 6
Wh_r Root 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0438500 [Oryza sativa (japonica cultivar-group)] >gi|46981295|gb|AAT07613.1| putative soluble inorganic pyrophosphatase [Oryza sativa (japonica cultivar-group)] >gi|113579209|dbj|BAF17572.1| Os05g0438500 [Oryza sativa (japonica cultivar-group)] >gi|125552482|gb|EAY98191.1| hypothetical protein OsI_20104 [Oryza sativa Indica Group] >gi|125594381|gb|EAZ34440.1| hypothetical protein OsJ_017923 [Oryza sativa (japonica cultivar-group)] >gi|215765536|dbj|BAG87233.1| unnamed protein product [Oryza sativa Japonica Group]
Score 932
Evalue 1.38119e-98
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15360
aattcggcacgaggCAACGAtgcCAGCGCACACAG*CAAATTAAG*CAGCGACCTCCTT*CGAT*CGAAG*ATGAGCCAGgcaCAAGGCCGCCGGCGAGA
AGGCGGCGGCGGAGCCCAAGAGGCAGACGCCGCGGCTCAACGAGCGGATCCTCTCCTCCCTCTCCCGG*AGGTCCGTCGCCGCCCACCCGTGGCACGACC
TCGAGATCGGCCCTGGCGCTCCGGCGGTGTTCAACGTGGTGGTGGAGATCACCAAGGGGAGCAAGGTCAAGTACGAGCTCGACAAGAAGACCGGGATGAT
CAAGGTCGACCGGATCCTCTACTCCTCCGTGGTGTACCCTCACAACTACGG*CTTCGTCCCACGCACCCTCTGCGAGGACAACGACCCCATCGATGTCCT
CGTCCTCATGCAGGAACCAGTCCTCCCCGGCACCTTCCTCCGGGCCAGGGCCATCGGCCTCATGCCCATGATCGATCAGGGAGAGAAGGATGACAAGATC
ATAGCCGTCTGCGCCGACGACCCCGAGTACCACAACCTCAACCATCTCAGCGAGCTCTCTCCCCATCGCCTCCAGGAGATCCGCCGCTTCTTCGAAGATT
ACAAGAAGAATGAGAACAAGGAGGTGGCTGTCAACGACTTCCTCCAGGCCGATGATGCCCGTGCTGCCATCCAGCACTCCATGG*ATCTGTACGCGGAAT
ACATTATGCACAGCCTAAGGCAGTAGAGTGTGTACTATTACTATTTTTCCTTTGCCCTTCCTCCTATGATGGGATGCAAAGAAGATCCCCTCGGAACATT
TGGGGTCTGATGAACAACCAAGCGAGCCTGTATTTCTACATTCTTGCTTTGTATTAGCCATATTTTCCCATTACTGTGGCACTATGTATCTCAAATTTGT
ATTCGAGACCTTGTGGTTTGG*CTCGTGTATTATCTTCAGTTCTTACTGGACGGACAATAATATAACAATTTATCACATTGATGT*CTGAGATACTGTGG
TAATGCCATAT*CTCAAATTTGTATT*CTAGACCTCGTGGTTTGGCTCGTGTATCTTCAGTTCTTATTacnaaggaACAATAATATAACAat
page-top