Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15358  (registered. 2007)
Contig Information
Length 737 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_r Root 4
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ribosomal protein L26 [Oryza sativa Japonica Group] >gi|125524352|gb|EAY72466.1| hypothetical protein OsI_00322 [Oryza sativa Indica Group] >gi|125524355|gb|EAY72469.1| hypothetical protein OsI_00325 [Oryza sativa Indica Group]
Score 549
Evalue 1.76631e-54
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15358
gcagaaccctaG*CCGCCGTCGCCCCAGGTAAGGG*AGAG*AGCCTACCCCCCGCCGCCGCCATGAA*GCGCAACCCCCGCGTCACGAGCTCCCGCCGG*
AA*GTGCCGCAAGGCGCACTTCACGGCGCCGTCCTCCGTCCGC*CGCGTGCTCATGTCCGCGGCCCTCTCCTCCGAGCTCAGGCACAAATACAATGTGCG
CTCGATCCCCATCCGCAAGGATGACGAGGTGCAGGTCGTGCGCGGCACCTACAAGGGCCGCGAGGGAAAGGTGGTGCAGGTGTACCGCCGCCGCTGGGTC
ATCCACGTGGAGCGGATCACCAGGGAGAAGGTCAATGGATCCACGGTGAACGTCGGCATCCACCCCAGCAAGGTGATCGTCACCAAGCTCAAGCTCGACA
AGGACCGCAAGGCGCTCCTCGACCGCAAGGCTCGCGGCCGCGCTGCTGACAAGGCCAAGGGCAAGTTCACGGCGGAGGACGTCGCCGCCGCCGCTGGAGG
CGCCACGGCCGCCGGTGCCTCGCTCCAGGAGATCGATTAAGCTTTGGGATCTGCCGGTTGCCATACTGCTCTTGATATCCTAGTTTTATTACCACCGCCT
GTTCTGTTAGGATATGCACTGCTACTTTATCATTCGTAAGATGT*CCC*TGG*ATG*AGTGTTTGGAACCTTTATGTGCATC*TATCATGGGT*CTG*Cc
tTGGATTTtg*ATATGAAGACTT*CATTATatgttta
page-top