Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15354  (registered. 2007)
Contig Information
Length 912 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 6
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0780400 [Oryza sativa (japonica cultivar-group)] >gi|75261957|sp|Q9AY76|ADF2_ORYSJ RecName: Full=Actin-depolymerizing factor 2; AltName: Full=OsADF2; Short=ADF-2 >gi|12957717|gb|AAK09235.1|AC084320_22 putative actin-depolymerizing factor [Oryza sativa (japonica cultivar-group)] >gi|108711379|gb|ABF99174.1| Actin-depolymerizing factor 6, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549920|dbj|BAF13363.1| Os03g0780400 [Oryza sativa (japonica cultivar-group)] >gi|215706463|dbj|BAG93319.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218193843|gb|EEC76270.1| hypothetical protein OsI_13741 [Oryza sativa Indica Group]
Score 698
Evalue 1.43826e-71
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15354
gtattaatacccaacacatgcgtttttcagggaggtttcttgcgtttacaGGCTCCGACATCATACGAGTAGAGAGACCTCGGACAACACTTCATCAGCT
AGAGCCATGCATAACAGCTGAATGATACTCTTACGTTTTACAGGAAACCTGGATATATCTGTCTTATTAACAACACTGCGGCAACAGCATTACCACGGAC
AGCATGAATTTGCATCCGACTGAAGCCCACGGGTGATCATCGATCCGCCCTAGTGCGCCCGGTCACGGAGGACGTCGAGCTCCACCTCGGTCGGGTCAGT
TGCTTGGATCTCGTAGTGGAACCCGTCGAGCTCCTGCTTGATGCGGTTCTTGGAGGTGGAGTACAGCATCTTGGCGCGGATGCGGGATGTGTCAGGGGAC
CAGGCAATGAAGAAAATCTTGCTTTTCTGCACATTCTCCCCAGTAACAAAGTCAAAATCATAAAGGGCATATCTGCAGTCCTTTTCTGGGAGACAAGCCA
GGAAATCATCATAACTCTCAGTTGTAGCCCCTGTCTTCTCCACAACAACCTGTTTTTGCTTTTCTTCGATTTTGAAGATAACATAGCGAAATGCCTTCTT
CATCTGAAGCTCCAGGAATGTCTCCCTGATATCAGGAGCAACTCCCATGCCAGAGGATGCATTGGAGGAGGTGCGCATGAAGGCCATGGGGTCGGGTCGG
AGCGGAGGGGAGGGGGACGGGCGGCGCCTCCGCGTCGATCGCACGCGGACGAGGAGGAAAGGAGATTATT*CCCGTTGCTGTTCTC*TTTTTTTTTTCAG
AGGGAGCGCTGTTGGCTGCGT*CtGTTGGTgtggcgaggaggactcaagagtcagaacggggcgtgcgttcatatacgcgcacgcacgcaggcgctgatg
cgccgctgcggc
page-top