Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15331  (registered. 2007)
Contig Information
Length 817 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 1
Wh_r Root 4
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Phosphoglycerate kinase, cytosolic >gi|21835|emb|CAA33302.1| unnamed protein product [Triticum aestivum]
Score 675
Evalue 5.40199e-69
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15331
tggccgtacatgacaaggtttcatttcaaactaaaacagagcaaacAACACAGAAGGAAACCGGACACAGACGCAGAGCTTAAAACCATACACATCCACA
GGGGTACGTTAAATTCCAGTCACCTCACTTCACTCGCACAGAGGAAGTTCATAATTATTCACGACTCACCTAATAGCAAAAATTGGCGACAAGCCTATCT
CAAAGTTTACTTGGG*ACATATAACGTTGCAGCGTTACACCGAGATGAGATCCCAAACAAAAGGGCACGCAGCAAGCTGATAGGTGAAACCGAATCAACC
TACGCCTCGTCAAGGGCAAGAACACCTGGGAGGGGCTTGCCTTCCAGCAGCTCCAAGCTCGCGCCACCGCCGGTCGAAATGTGGCTCATCTTGTCGGCCA
GCCCAGCCTTCTCAACAGCAGCAACGGAGTCACCTCCACCAATGATGG*TCGTGACACCCTTCCCAGTAAGCTCAGCCAACTGCTTCGCGATTGCATCAG
TGCCTGCGGCAAACTTCTCAAACTCAAAGACTCCCATAGG*ACCGTTCCAGATAACAGTCTTGGTGG*TGTCCAGGGCTTCTGCGAAAGTCTTGATGGAA
TCTGGGCCAACATCCAGACCCATCCAACCATCAGGGAT*AGCA*GTGGCAGGAACAATCTTGCTTTCGGCATCTGCTGCAAACTTGTCAGCCACAACGAC
ATCAGTCGGAAGCAAGAGCTTAACACCCTTGGACTTT*GCCGTTTCGATCAGTGAAGTTGCCAGTTCAAGTTTGTCTTCCTCCACAAGAGACTTTCCAac
cctcgtgccgaattcct
page-top