Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15329  (registered. 2007)
Contig Information
Length 674 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 6
Wh_f Spike at flowering date 2
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=40S ribosomal protein S27; AltName: Full=Manganese efficiency-related protein 1 >gi|14140095|emb|CAA59732.2| putative zinc finger protein [Hordeum vulgare subsp. vulgare] >gi|14495006|emb|CAC42134.1| putative ribosomal protein S27 [Hordeum vulgare subsp. vulgare] >gi|14495008|emb|CAC42162.1| putative ribosomal protein S27 [Hordeum vulgare subsp. vulgare] >gi|14495010|emb|CAC42163.1| putative ribosomal protein S27 [Hordeum vulgare subsp. vulgare]
Score 403
Evalue 1.29964e-37
Total Hit Count 352
Registered year 2007
Contig Sequence     [ Download ]
>Contig15329
ttttttttttgaaatataAGGCGTGCCCGCCGAGTTTGAGGGGTCGGATTTgCcaTATATACCAAACACTGAACACTGTCAAGAGAATGCAGCAGGCTAT
TACTACTACATAACAAGAACCAAACTTAGATATCACCAGGCAGCCAGACAAACAGAAGCACCAACAACAGGCCACTCAAAAAGTGCATGACATAGAACAC
GTTGGTACAACGTTC*AGG*CTGGCAAACGGGCAAGCATAATTAACAAAATTTGACCAGTACACATTCAGGATAACTAGTTACTTGAAAAGTAAGGTTCA
GCAGGGCTTCATTTTCCCATAAACAGGCGTGCAGCTTAGTCGCCCTTCCGGCGGAAGGAGCATCCCTCGGTGAGCCTCGCTTTTCCTCCGGTGGGTTGGC
AGAGCACCGTCTGGCAGCCAGGGCACACCACCACGGTCTGAGAGTGGCTGAACACAGTTGTTATGTTGAAGCAGCCCTGGCACTTGACATCCATGAAGAA
GGAGTTGGGGGACTGCACGAGGCGCTTCTTCTTGTGCTTGAGCTTCTCGAGCTCCGCCGGCGGGTTGAGGAGGTCGATGTCGTTCTGCAGCACCAT*CTT
GACGGGCGGCGGCGGTCTTCGCGTGGGAGAGGATGCGGGGACGGGGTGGCGGCGGTGGAGAGGAGCGGAGGCgc
page-top