Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15260  (registered. 2007)
Contig Information
Length 2181 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 10
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit TCER1 [Triticum aestivum]
Score 2662
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15260
tcTTCCTTGTGATTGGCC*TTGGGGTGGCCGGGTGGGAAGCAAGGAAGGAAGGAAGGAAGGAAGGAGGCGACCACAGGCAGTCATGGCGACCAGGCCGGG
GCCTTTGACTGAATGGCCATGGCAGAGGATGGGCAACTTCAAGTACCTGGTGATGGCGCCGGTGGTCGTCCACGGCGCGTACCGGGTGATGAACAAGGGG
TGGGGCGACATCGACCTGGCCTACTCGCTGATCCTGCCGTCCCTGGCGCTGCGGATGATCCACAACCAGATCTGGATCAGCCTGTCCCGCTACCAGACCG
CGCGCAGCAAGCACCGCATCGTCGACCGCGGCATCGAGTTCGACCAGGTGGACCGCGAGCGCGGGTGGGACGACCAGATCGTCTTCAACGGGCTGCTCTT
CTACGTGGGGTACCTGGCGATGCCGAGCGTGCGGAGGTTCCCGCTGTGGCGGACGGACGGGGCGGTGGCGACGGCGCTGCTGCACGCGGGGCCCGTGGAG
TTCCTCTACTACTGGTTCCACCGCGCGCTGCACCACCACTTCCTCTACTCGCGCTACCACTCCCACCACCACGCCTCCATCGTCACCGAGCCCATCACCT
CTGTCATCCATCCTTTTGGCGAACACATCGTCTATTTCACGCTCTTTGCAATCCCGATGTTGTCCACAGTTTATATGGGAAATGGCTCCGCCCTCGTGTT
TGTGCTGTATATCGTTTACATTGACTTCATGAACAACATGGGGCACTGCAACTTTGAGTTGGTGCCAAAGTGGATGTTCCAAGTCTTTCCTCCTCTCAAG
TACCTCATGTACACCCCATCGTTTCATTCCCTTCACCACACGCAGTTCCGCACAAACTATTCACTCTTCATGCCATTTTACGACTACATATACAGCACTA
TGGACAAGGCATCTGACGAGCTGTATGAGAGCTCACTGAAAGGGACAGAGGAGACACCTGACCTTGTTCATCTCACACATATGACCAACTTGCAATCGGC
TTATCATCtaagggttggattcgcctccatagcatccaaaccatctgataactccgagtggtatatgtggacgctatggcccttggcATGGCTGTcaatg
gtggtAGCATGGATTTATGGgtcatcTGCATTCGTGGTCGAGAGAatcaaacTGAAGAAGATGAAGATGCAAACATGGGTCGTACCGAGATACAACTTCC
AATATGgtgtgACATGGGATAGAGAATCGATCAATGACTTAATTGAAAAGGCGATATTGGATGCTGATGTAAGAGGGGTTAAGGTGCTCAGTCTAGGGCT
ACTAAATCAGGCAAAACAGCTCAATGGGAATGGTGAACTATTTAGACAAAAATACCCAAAATTAGGAGTTCGAATTGTTGATGGAAGTGGCTTAGCAATT
GGAGTTGTCCTAAAAAGCATCCCTTCAGATGCAAAGCAAGTTTTTCTTCATACAGGGACTTGTAAGATAGCCCGTGCCGTTGCTATGGCTTTATGTGGCA
AGGGCATCCAGGTGATCATGAATCGTAAGAAAGAGTATGACATGCTCAAGTCACAGATGCCAGAGAACAGAGCAAGCTACTTGAAGTGCTCCAGCAATGA
CATAACCAAgtttatggcAGATTTGGCTAGTAGAGAGGATCGACGACAAAGAACAGAGGATGGCACCAAAAGGAACAGTGTTCGTTCCAATATCGCAGTT
CCCCCTTAAGAAAGTCCGCAAGGACTGCAC*TTACTTGAGCACTCCGGCGATGAAGATCCCGGACACTATGCAGAACATCCACTCCTGCGAGAACTGGTT
GCCGAGAAGGGTGATGAGCGCGTGGCATATCGCCGGAATACTTCATGTCCTGGAAGGGTGGAGCGAGCACGAGTGCGGTGACCACATGATGGACTCTGAG
AAGGCATGGTCGGCTGCTATCAGGCACGGCTTCATCCCTCTCACCAAAG*CTTGACTGGGGAAATGTTGCTAAGATGGTACTACCGAGAATTTATGCTAA
AACCGCAGCCTTTTTTTCTTTTCTTTTGGGACCACGCAGGAGAT*CTGTTTGGTCGGACAGCTAAGTCTGTAAGATTTATCAGTGTGAACATCGAACATC
AATTCAATTAACTTACTGCTTAtggatttgaattccccgcaaacaaaaagtttgaattggtagtgtccttcaaaaaaaaaa
page-top