Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15259  (registered. 2007)
Contig Information
Length 1219 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 3
Wh_r Root 5
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0182700 [Oryza sativa (japonica cultivar-group)] >gi|52353745|gb|AAU44311.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113578372|dbj|BAF16735.1| Os05g0182700 [Oryza sativa (japonica cultivar-group)] >gi|125551090|gb|EAY96799.1| hypothetical protein OsI_18727 [Oryza sativa Indica Group] >gi|125593051|gb|EAZ33110.1| hypothetical protein OsJ_016593 [Oryza sativa (japonica cultivar-group)] >gi|215737478|dbj|BAG96608.1| unnamed protein product [Oryza sativa Japonica Group]
Score 935
Evalue 7.38756e-99
Total Hit Count 225
Registered year 2007
Contig Sequence     [ Download ]
>Contig15259
ggtTTTCCTCCTCCACCTCCACCTCCACCGGCATCACCTCGG*ACGCGCGGCGGCGTGCAGCCATGGCGATGGTGGCACAGGCGGGCTTCGGCCTCACCC
GCGTCGTCATGCTCGTCGGCGCGGGCGTGGCCGGCTCCGTCGTCCTACGAAACGGCCGCCTCTCGGAGATCCTCACCGAGATACAGGAGTTTCTGGAGAA
GGGGGAGATGGGTAAGGGAGGAGGC*GGTGGTGCGGACCACGGCATCAACGACGCGCTCAACGAGGTGCGCCAACTTGCTATGCAGGTACGCAATCTAGG
TTCTCCACGTTCGATAACTGTTCTCAGTGGAGGTTCTGGACAAACAGGAGTATCAGGATTAATAGTACCTGCAGCAACTGTTGGAGCACTGGGTTATGGT
TATATGTGGTGGAAAGGCATCTCCTTTGGGGACTTAATGTATGTCACCAAGCAAAACATGG*CTAATGTTGTTTCAAATATGACTAAACATCTGGAGCAA
GTTCAGAGCTCTCTTGCTGCTGCTAAAAAGCATTTGACACAACGCATTGAGAAGTTGGATGACAAATTGGATCAGCAGAAGGCGCTTTCTGGGCAAATAA
AAGATGATGTTACTGGCGCACGACTGAAGCTTGAGAATATTGGTTCAGAGATTAAGAACATCAAAGAATTGGTCTGGGGACTGGATGAGAAGATGGATTC
AATGGAAGCCAAACAGAATTTTTCATGCGCTGGTGTGATGTACCTCTGCCAATTCATAGAGCAAAGTGGTGGGAAACTCCCTGAACGCCTGGAAGGCATT
GAACCATCAGCGAAGCGATTTGAAACAATTGGCATACAGGGGTTGCAACTAGCCATAGAAACAGGGAATTTTAGTGATTTCAGCAATGCTGATTCCACTG
ACAAGATAAGCAGGTCCAACTCGTTAAAGTCTGCCAACTAATTTTCTTCGGGGTTGGCGAGACATGTATCCAGATTCGTTACTTAGTGGAACATTGTAAA
GGGAGATTCTTGCTGGATAAAATGTAAAGAGTCCCAGCCTTTTTGTTATTTGCTTGCAGGAAGTGCTGTTTGTTAAATTTGAAAACGTGTGCGAAGTAGT
AGCTACTATGGAATCTAGACCAGATGTTATTCTGGCATCACTTATGCC*TTGCATTTTTATGCAATACTTGCCGTAAATAAA*GGACGACActccaGTTT
Ccttgaaccaaaaaaaaaa
page-top