Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15242  (registered. 2007)
Contig Information
Length 777 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 7
Wh_r Root 2
Wh_yd Spikelet at late flowering 3
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_19960 [Oryza sativa Indica Group]
Score 1151
Evalue 3.20688e-124
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15242
tcggcacgaggaatCCCCATCCCCCCTCATCCCCCCACGCGCGACGCGAACTCTTCAATCCTCTCCTCAGGGAGCGTAGGGAGGCGAAGATGAGGGAGAT
CCTGCACATCCAGGGCGGGCAGTGCGGGAACCAGATCGGGTCCAAGTTCTGGGAGGTGGTGTGCGACGAGCACGGCATCGACCCCACGGGGAGGTACGTC
GGCACCTCCGACCTGCAGCTGGAGCGCGTCAACGTCTACTACAACGAGGCCTCGTGCGGCCGCTTCGTGCCGCGCGCCGTGCTCATGGATCTCGAGCCCG
GCACCATGGACTCCGTGCGCACGGGGCCCTACGGCCAGATCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGCGCCGGCAACAACTGGGCCAAGGG
CCACTACACCGAGGGCGCGGAGCTCATCGACTCCGTCCTCGACGTCGTCCGCAAGGAGGCCGAGAACTGCGACTGCCTCCAAGGCTTCCAGGTGTGCCAC
TCCCTCGGCGGGGGCACCGGTTCCGGCATGGGCACGCTGCTGATTTCCAAGATCAGGGAGGAGTACCCGGACCGGATGATGCTCACCTTCTCCGTGTTCC
CATCCCCCAAGGTGTCTGACACCGTGGTCGAGCCCTACAACGCCACCCTCTCGGTTCACCAGCTGGTGGAGAACGCCGACGAGTGCATGGTGCTGGACAA
CGAGGCGCTCTACGACATCTGCTTCCGCACCCTCAAGCTGACCACACCTAGctttggtgacctgaaccacttgatca
page-top