Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9408  (registered. 2012)
Contig Information
Length 1475 bp
Clones alternative view 67 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 3
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_PCDAM Anther at meiosis 4
Wh_SHDr Shoot grown with dessication 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 5
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_SP 2
WH_XA Root 2
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|33526877|gb|AAQ21396.1|| ribosomal protein L3 [Triticum aestivum]
Score 800
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9408
CACAGCTGAAACATTTGCTTCCAAATTTGAAGGCATGCAAATAGCATTACTATTAAGTTCAAAATGCATAAACCTCATCAGTTCAAACATTCGCAGCAGC
TCAGAGTTGCAATTGCAATGCATAAACCGGTTCCCAAACAATCTGCCACAAAGCAAGAAAAAAAGCTGGTAACACTATGGGATAAGATCTGTCGCAGCCT
AAGCCTTGAGCCTGCCGTAGAACTTCTGCTTCTCGTCAGTGGTCTGGAACCGGCCATGCCCGAACTTGGATGAGGTGTCGATGAACTTGAGCTTGATCTC
CTCAAGGGCCAACCGCGAGGTCTGCTTCAACAGGGACTGGCGGAGGGTCACCACTCTCTTCTTGGGGCCCACACAGCAGCCCTTGATCATGAGGTAGTCA
CCCTTCACCACACCATAGTGAGGGAAGCCACCCATCGGGGTGATGTCCTTCTCAGTCCTGTCAAACTCAGTGCAGGCCTCGTGAGACTCCTGTCCAGACT
TGCCCATCTTGTAAATCTTTTTGTTCATCTCTGTGCGGTGGTGGTAACCATTCTGACCAGCACGAGCAACAGTGTAGGAAACCCTAGCAGGATGCCAGGC
ACCGATACAGGCAACCTTTCGGAGACCCCTGTGGGTCTTGCGGGGAAGGCGGGTCACACCCCAGCGAGTGACGACACCTTCGTACCCCTTACCCTTGGTG
ACACCAATGATGTCAACCATTTCATCTTTCTGGAAGACCGCTTCAACTGGGACTTCCTTCTCAAAGAACTTGTAGCCATAGTCAACCTTGTCTGCGATGG
TGCCACCATTAACCTGGATCTCCATGAGGTGAGCCTTCTTCTGTTTCAAGCCCTTCATCTTCCTAATCTGAGTATGGGCAATAACACGGACTATAGTGGC
GTACTTCTTCATTTTCTCAAGCTGCAACTGGATTTCCTTCTTGCCTGCATCACTGTCATACTTGAGGGCATACTTTGTGAACGCCTTCTTCTTGCTCTTG
CACCAGTTCTTATAGAACCTTCTCCTCACATCTTCGCTAAGGTGCTGAGCCCAGACAGAGTTGAGAGTGCGAAGGCCACGTGGGGTCTTCACATAGGCCA
CAAGACCAACAATGACCAGAGGAGGGGTCTCAATGATGGTAACAGCCTCACAGGTTTCCTTCTTGTGGAGCTTGGATCCGGGCTTCTCGACCTCACGAAC
AATGTGGGTCATTCCAGCCTTGTAGCCCAGAAAGGCAGTGAGGTGGCAAGGCTTCTGTTGGTCATCCTTGGGGAAGGACTTCACCTTTCCGCGGTGGCGA
GAGCAGCGCTTCCTGGGGAGGAAGCCGAGGGAACCGTGCCTCGGGTGCTCGAACTTGCGGTGCGACATCGCCGCTCCTCCCTTCCTTGCCTCCGCGAAGG
AACTACGCGAAAGTGNNNGCTTCGGCAGCGGCAGATCGGCGAAGAGGCAGGAGGGATTGTACCTCGTGCCGAATT
page-top