Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15220  (registered. 2007)
Contig Information
Length 1714 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit eukaryotic translation initiation factor 3 subunit 6 [Zea mays]
Score 1864
Evalue 0
Total Hit Count 275
Registered year 2007
Contig Sequence     [ Download ]
>Contig15220
caaaaatgtttaacaggaagctaagctagacagacaacagggagctcaaagacaattgcagacaggccgagaaagacagtaaaatatgcaatgacacctc
agcaaggaAATGCGTTAAACGTCTTTTGCAGTATTAAattcATAGGACGATAAACTTGAGTAAAAGGAGTACAAAGCATTTAAAACATCAGCATAAGCTG
TAGCAATGTGATTCAAATACTAGCAACGAAGTCACTGCCTAACAACAAAGTTCCCAAAGTAATTTTTACCGCCTCAAAGCTGCAGATCATCTGTTGGTCT
CACCGAGCAGCCTGCTGTGCTGCTGCATGCCCTGGATCCACGACGCTCTTTGCTAGCATGTAGGTCCTGGCATTGAGGTTCTTCATGCTCTCAATAATCT
GCTCATGGACATCAACACGATTGGTCGTCATGATGAGAGTTCCCGTCACTGAATCAATCTTGGCATCTAGCTTGGAACTCTTGACCATGTTCATTATCCA
CAACTCGGCTTCATCATAGGTCATGTTCAGCTTCTCCGCAAGCACACCAATATCGATGCAGCGATGTATACGGCAGTAAGTCTCAAAAATGAACAGGCGA
GCATTTTCAAGGAACTCGTCT*CTCAGAGGAACAGCGATGCCATTCCTCTCTTCGACGCGCTTCCCCAGGAAAGGATCATTCAGTATAACCTGCTCGCAC
TCGACGAGCTTCTGCTGAGCGCCATCAAAATCATACTTGACATACAGGCACTCCAGGAACTCAATGATGGGATCCTTGTAGCTGTTCTGCTCCTGCTGGA
TGACCTTGATGAGTTCCTTAAGCATGTTCCTTCTCCTCTTGTTGACAACAACTGCAGCAGCAAGGTACCTCAGAAGATGGGGAGCGTTGGTCTGGATAGC
ATTGAGGTACCTGTCCTGGAAGAAGAGGTCGATGATCCCGTTCCTTCCATTCTCATGGTTGAAGAAGATGAAGAGGCTCCAGTGCatcagCCATATCCTG
CTGTGGAGCTGgttcacAGGCGACGAGGTGAAGCTGCTGGAATCAATCATCTCCTTGAGCCTGTTGAGCTCCTCCTGCGCGACATCCCAGTTCTGCATCA
GTATCTCCGCCGCCAGCTTCCCCCACAGGGCACTCAGGCTCCTCTCGCTGTTGGTGCACAGAGCGCGGTACTGGGACAGGAAATCGGCGGCGTCGGAGTA
CATCCCGCACTCGTACTGGAACTTGGCGTACTGGTAGAGGGCCTCGATCTGGTCCGGGCCGATCTGGTGGCGCTCCTGGAGCATGTGGAGGTTGTACTGC
TTGTCGGCGTGGAGCTCCTGCACGAGCTGCGGGCTGGAGAGGAAGGCGACTATGGGCGCGACGGCCT*CCTGGAGGGCCCGGAGCCTCTCGACGACCTCG
GAGCGCCGGGCGACCATGTCGGCGGGGACGTCGTCGGTGCCGTGGAGCGACTTGTGGATGTCCATG*GCGTAGTCGACCATGTTGGTACCGCCGAGGAGG
CGGATCTTGCCACGCAGGATCTCCTCGTCGGCGTAGACCCCGCGCTCCTGGAGGAACTCCAGCACGGGGAGCACCAG*GTGGGGGTCCATCCACGCCGCC
ACGCTCGCCGTCAG*GTCGTGCTCCGCCATGGCTGTCTCGGGCGAGGGGATGAGAGCTAGGGTTT*CTAGGGTTTGTGGGTGGCGGCGGCGGGTGGAGGG
AGGGAGGGAagggc
page-top