Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15218  (registered. 2007)
Contig Information
Length 1057 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_h Spike at heading date 2
Wh_r Root 6
Wh_yd Spikelet at late flowering 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0516600 [Oryza sativa (japonica cultivar-group)] >gi|46575953|gb|AAT01314.1| putative GTP-binding protein Rab7a [Oryza sativa (japonica cultivar-group)] >gi|113579597|dbj|BAF17960.1| Os05g0516600 [Oryza sativa (japonica cultivar-group)] >gi|215767238|dbj|BAG99466.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767294|dbj|BAG99522.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1062
Evalue 1.11165e-113
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15218
tttaaGCTTctttncaCAAAACCTAATGAAGCAACTGTAGTTTACACTTCACTTATTTCGCCTGACTGTATTCACAAGATATGACGCTATTCATGATAAA
ACTACACAAACGTCCACAAATTGACAGCTCGGAACAGACGCATCAATCATTCCTTGGGCACTTACGAGGTGATTGAAAAAGGTCACAAATGAAATACGGG
CCCACAAGTCACCATGGAAATACAGTAATGTCAAAGGAATAGCTGACAGTTGTGGCCTCAGGTTCTAACAGCATCCTGATGATCCTTGACCCCGGTTGCC
ACCCACCACGTCCACGGTGTCCGGCATATACAGTTCTTCCTCTGGCTCGTTCTTCAGAGCGTTCTTTACTATACACTGGAAA*GCTTCCTCCACGTTGAT
TCCATCCTTGGCAGAAGTCTCAAAGTATGGGATGTTCCCTTTAGAGGCACACCATGCCTTCGCCTTTTTCTCAGAAACCACGCGACTATTCCCGCCATCT
ACATCAACTTTGTTACCCAGCAGAACAAAAGGGAAGTTATCAGGAT*CTGATGGGCTA*GCCTGAATT*AGAAACTCTTCACGCCA*GTTGTTCAGATTA
TCAAATGATTTCATTGA*GTTAACATCGTAAACTAGAACACAACAAT*CTGCACC*GCGGTAGAATGCAACACCAAGACTTTGAAACCTCTCCTGACCGG
CAGTAT*CCCATATTTGTAGGGTGAAGA*GCCTGTCCTCGAACTGCACCTCCTTGGTGAGGAAATCGGCGCCAATCGTAGCCTTGTACTGGTTGCTGAAC
TTCTTGTTCACATATTGGTTCATCAAGGAAGTCTTCCCAACCCCGCTGTCGCCGAGGATGATGACCTTGAGGAGGGTGCGGCGGCGAGAGGCCATCGGGA
TCTAGGGTCCGGCGCGATCGATCTCGCTCGCGCGCCGGAGGGGACTGGAAGGGGGCGGGGGAGGCGAGGCGAGACGAGACGAAAGAGCTGAGCTGTCGCG
GCGCGTCGACTCGTGtgntnctGTGGTGGGCGACgcgagagagggcctcgtgccgaa
page-top