Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15215  (registered. 2007)
Contig Information
Length 1782 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 1
Wh_oh Pistil at heading date 1
Wh_r Root 3
Wh_yf Spikelet at early flowering 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1567
Evalue 6.35497e-172
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15215
aggaattcggcacgaggccgtgttccccatctCTCCtcccagAACCTCGTCTTCCTCCTCCTCGCCGCCGCCGCCGCCGCCGCCGCCGAGGATGGC*GGC
GAAGCAGCCGTTGTCGGACGTGGAGGACGGGCTCCTCGCCCACCTCAACGCGAACGCCGAG*ATCCCCGACTCCCGCTCCTTCGCCTCTTCCCTCGGCGT
CCCGCACAAGggaTGTGGAGGACGTCATCAAGAGGCTCACCGCCTTCCGCATCGTCGAGAGTGCGGACATCACCAAGG*AGACGTGGGTGCTCACCGATG
AGGCCAAGGGGTATGCCGCGAGGGGCTCCCCCGAGGTGCAGCTCGTCGCGGCCATCCCGCCCGAGGGTGCCTCCAAGGGCGCGCTCAAGGAGAGTTTGGG
GGACGTGTTCGATATTGGAATGAAGGCTGCAGCCAAGAACAAGTGGATTGGATTTGAGAAGGGAAACAAAGACCTCGTACTGAGAAAGGTTGAGGATACC
AATGATGAATTGCAAGAGCAGCTTATAAGACTGGAGAATGGGGAGGTTATTGCTGACAAAGTAATAGATGATTTGAAGAGAAGAAAGCTTGTAACAAAAG
AGAAATCTATTTGGTATTCACTGAAGAAGGGGCCTGAATTTGTTGCAAAGAGAAAAACATTGGCAACCCGATGTGACACGAGAACATCTCAAGAGTGGCG
ACTGGAAGGATCTGGAATTTAAAGATTATAACTATGGAGCTCAAGGACAACCTATTGCGATAGGATATAGCCAACCGTTGTTAGAGGTCCGTGAGGCAAT
CCAGAACATTTTTCTCGAGATGGGGTTCAGTGAGATGCCAACGAACATGTATGTAGAGAGCAGCTTCTGGAattttgaTGCACTGTTCCAGCCACAACAG
CATCCTGCTCGTGATTCACACGATACCTTTTTCctcaaagcccctgctacaacaacacaattacctgatgactatcttgagaaagTAAAGCAAGTACATC
AGTCTGGTGGTCAtggctcCAAAGGATATGGTTACGATTGGAAGCGAGATGAAGCAGAGAAAAACCTGCTTCGTACTCACACAACTGCAGTTTCAACAAG
GATGCTATACAAGCTAGCACAGGAGAAAACTTTTGCTCCTAAGAGATACTATTCTATTGATCGTGTTTTCCGGAATGAAGCTGTGGACCGAACTCATCTT
GCAGAATTCCACCAGATAGAAGGTCTTATTTGTGATTATGGTTTGACGCTTGGTGATCTGATAGGTGTATTGGAAGATTTCTTCTCCAGACTAGGCATGT
CAAAGCTGCGTTTCAAACCTGCCTACAACCCGTACACTGAACCAAGCATGGAAATTTT*CAGCTACCACGATGGTCTGAAGAAATGGGTGGAGATAGGCA
ACTCAGGCATGTTCAGGCCTGAAATGTTACTTCCCATGGGACTGCCAGAGGGCGTTAATGTTATCGCATGGGGTCTTTCACTTGAAAGGCCAACAATGAT
TCTGTATGGGATTGACAACATACGTGATCTCTTTGGGCCAAAGGTCGACTTCAACCTGATCAAGAGCAGCCCGATTTGCCGCTTGGGGCTGTAGTGAGCT
TTTTTTTAATGTAGTGAGGTTGATAGAACTTTGTCTGGATGTCTGGATGGGAAGGATGTTTATTTGTGGTTATACCTTTGAAAACTAGTACTTGTGCATT
TAACAGAGGGAGTGCAGAAATACACACATGTTGTAG*CtCTGAATAGCAATTTCGAGGTGTTCATGTTcgtatgcaagtagg
page-top