Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15198  (registered. 2007)
Contig Information
Length 1299 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_dL Crown of seedling 6
Wh_h Spike at heading date 2
Wh_r Root 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Mitochondrial outer membrane porin; AltName: Full=Voltage-dependent anion-selective channel protein; Short=VDAC >gi|456672|emb|CAA54788.1| voltage dependent anion channel (VDAC) [Triticum aestivum]
Score 1350
Evalue 6.11274e-147
Total Hit Count 383
Registered year 2007
Contig Sequence     [ Download ]
>Contig15198
gaggaattcggcacgaggccccgCTCCTTCCCTCCCCtccaccaCCTATCCGCCGCCTCCCCCCACCCTCCACAAACCCACGCAGCTCCAGCGGCGCAGG
CGCATCCCAGCTCACCGGCGGAGATGGGCGGCCCAGGCCTCTACTCCGGGATCGGCAAGAAGGCCAAGG*ATCTACTGTACAGGGACTACCAGACCGACC
ACAAGTTCACCCTCACCACCTACACCGCCAATGGCGCCGCAATTACTGCTACCAGTACAAAGAAGGCTGATCTTATACTCGGTGAGATCCAATCACAGAT
CAAGAACAAAAACATCACTGTAGATGTGAAGGCCAACTCAGCATCGAATGTCATTACTACAATTACCGCTGACGATCTTGCAGCACCAGGGCTGAAGACC
ATCTTGAGCTTTGCTGTTCCTGATCAGAAATCTGGAAAGGTTGAGCTCCAGTACTTGCATGATTATGCTGGTATTAATGCAAGCATTGGCTTGACTGCCA
ATCCTGTAGTCAACCTCTCCGGCGCGTTCGGAACTAGTGCTCTAGCTCTTGGTGCTGATGTGTCGCTTGATACAGCCACCAAGAATTTCACCAAATACAA
TGCTGCACTTAGCTACACTAACCAGGATCTTATCGCATCCCTGAACCTGAACAACAAGGGAGACAGCCTGACTGCATCCTATTACCACATTGTGGAGAAA
TCCGGCACAGCTGTTGGGGCAGAGCTGACCCACAGCTTCTCAAGCAACGAGAACAGCCTCACCTTCGGCACCCAGCATACCCTGGACCCGCTCACCCTTG
TGAAGGCCCGGATCAACAACTCTGGCAAGGCCAGCGCGCTGATCCAGCACGAGTTCATGCCAAAGTCGCTGTGCACCATCTCGGCGGAGGTGGACACCAA
GGCCATCGAGAAGAGCTCGAAGGTCGGCATTGCTATTGCTCTCAAGCCTTGATTGCGGAATCAAGCCCCCCTTCTCTAAGCTCTCAGTCAGGGGTGTTCc
ctCGGTTTCGGATGAAATCGGGGCGGGTTGACAATACTTCACACGCCCTTGGGCGCGTTGTTGCAGTCTGTTAGATTTGAAGAACTGCCGTGTTTCATT*
CCTGAGGAATTTTGTCTTTGCTCGGTGTAGTGCCTGTCCGTTGAGCCACACTCGCAGTAATAATTCAAGCTCTGAAAATTCTGAACTTGATTCAGCATTC
GTCAATTTTTTAACTTG*CTGTGGTGTagcctactttccaagggagaagataatgattgttgcctgagttgagccctcgatccggcaataaaaaaaaaa
page-top