Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15163  (registered. 2007)
Contig Information
Length 989 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_h Spike at heading date 10
Wh_oh Pistil at heading date 2
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0195600 [Oryza sativa (japonica cultivar-group)] >gi|75123464|sp|Q6H7P8|SAP4_ORYSJ RecName: Full=Zinc finger A20 and AN1 domain-containing stress-associated protein 4; Short=OsSAP4 >gi|49388120|dbj|BAD25251.1| putative zinc-finger protein [Oryza sativa Japonica Group] >gi|113535717|dbj|BAF08100.1| Os02g0195600 [Oryza sativa (japonica cultivar-group)] >gi|125538468|gb|EAY84863.1| hypothetical protein OsI_06227 [Oryza sativa Indica Group] >gi|125581153|gb|EAZ22084.1| hypothetical protein OsJ_005567 [Oryza sativa (japonica cultivar-group)] >gi|215692751|dbj|BAG88171.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215695215|dbj|BAG90406.1| unnamed protein product [Oryza sativa Japonica Group]
Score 708
Evalue 1.13207e-72
Total Hit Count 419
Registered year 2007
Contig Sequence     [ Download ]
>Contig15163
aaaatgcaagtccacaCGCAATATGATGAacC*TTGCTGGCTACTATTACTGATCAG*AATTTAACACACATGGG*ACAATAGTACATAACAGAGCTAGC
TAAAATGAG*AAGCCACAATACTGACCGAAAAAACCACCATGAATAAAGTTACACAACACGCAAACCATTCGGAATGACTGAGGATTGAGTTCTTGCAGC
TGCCACGACGCAGTGTGCATCACGACGCCGTACAATTTAGGAAATGCGGCAGCCAACAAGAAAGGGAGGTGCAAGGATGGCACAGCAAAGACGGATGATG
AACCTTGGCAGATTGCAACCATTTCTTCCCTGTGGGACACCTAAATCTTGTCGAGCTTCTCTGCCTTCACCACTGGGTTGGCCTTGGCGATGGCATCCCT
AGCTGCAGTCCGGTAGTCGAACTGGCAGTCATGCTTGTCGGAATAGCGATGCAGCGAACAGTACATGTTACCGCAGCGGCAGTTGAATCCCGTCAGCCCA
ACCCTCTTCCTGCAAGTTGAGCACCGATTCGGCCCCTCCTTCCTCTTGGGGCTCACGGCAACAGCTTCGCTGGTGCCTGCAACATCAGCAGCAGGCTGCA
CAACGAGCGCCTTCACGTCAACTTGAGCAACCACCACCTCTGCGCTCGCGGCTACAGCCGCAACAACAGGTGCTTTCCCACCGTCGCCACCGTTGACGAT
GCTATCGAAGGAGGAGGCAGCCAGCTTGGCCTGTTCCTGCTTCATGACCATCT*CCTTGTGGCACTTGGAGCACATGTTCATGGTCGCCGCACTGCCAAA
GAAGCCACAGTTATTAACGCATAGGATTGGGCCCTCCGGCTGCTGGCAACCCGCCTCCTTGTGTTCCATCTTGAATAACCGTGAGCCTGTGGCGAGGCGG
CGGCGGCGGCGGGGCCGGAGGAGGAGGGCGAGGAGGCGTGCGGGGATTGGGAATCGCGAGGAGCTCGGCCTCGTGCCGAattncctgca
page-top