Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15160  (registered. 2007)
Contig Information
Length 998 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_e Seed DPA10 5
Wh_h Spike at heading date 8
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ras-related protein Rab7 >gi|1155265|gb|AAA85273.1| possible apospory-associated protein
Score 1068
Evalue 2.02876e-114
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15160
aatattattcattcCGCCGCATTCACAACAAACTACACAACATACAAGATGACAGACAGAACAGGACAGATCATCGAT*CCTTGATTTCGTACCGAAGGG
GTGATTGGTCAAGTCACAAATGGAATACAGAATAACATGATATTATACAGGCAGG*AAAGACAGCATGTTCAATGGTTGCTACGG*CCA*TGG*CGTGGC
ATGGCTTAGCAGCAGCCTGATGATCTTTGGGTGCGG*TTGCCACCCACCACATCGACAGTGTCAGGAATGTACAAT*TCTTCTTCTGGTTCATTCTTCAG
AGCATCCTTTACAATGCACTGAAAAGCGTCTTCTACATT*TGTCCCTTCTTTCGCAGATGTCTCAAAGTAAGGGATGTTGCCTTTTGAGGCGCACCAAGC
CTTTGCCTTCTTCTCAGAGACCACGCGGCTATTGCCACCATCAATATCAACTTTGTTTCCCAGCAGAACAAAAGGGAAGTTATCAGGATCAGACGGACTA
GCCTGGATCAGAAATTCTTCGCGCCAGTTGTTCAGATTATCAAATGATTTCATTGAATTGACATCATAAACTAGAACGCAACAGTCTGCTCCACGGTAGA
ATGCAACACCAAGACTCTGAAACCTTTCCTGTCCAGCAGTATCCCATATCTGCAGAGTGAAGAGCCTATCCT*CGTATT*GCACCTCCTTTGTGAGGAAA
TCCGCGCC*GATGGTAGCCTTGTACTGGTTACTGAACTTC*TTGTTCACATATTGGTTCATCAAGGACGTCTTCCCAACCCCGCTGTCGCCGAGGATGAT
GACCTTGAGGAGCGTGCGGCGTCGCGAGGCCATCGGGATCTATCTACCAAGCGCT*CTTGCTCGCGCTCGTCGCGCGCCGGAGGTAGGGTGGGGCACGAG
GTGGGGAGGGGACAGAGGAGGGAGAGACGAAACCTAAGCTTGCGTAATCGCGTTTGCTGCCTTGCCGTCGCAGGCGGGGAACAAGGGTGCgtttggcc
page-top