Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15148  (registered. 2007)
Contig Information
Length 1428 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 6
Wh_e Seed DPA10 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cellulose synthase catalytic subunit [Hordeum vulgare]
Score 1424
Evalue 1.8144e-155
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15148
gctgggtttaagatgcattgccatggctggcggtcgatttactgcatacctaaaagacctgcattcaaaggttccgcgcctctcaatcTTTCGGATCGTC
TTAaccaggtTCTTCGGTGGGCTCTTGGATCTATTGAGATCTTCTTCAGCAACCATTGCCCGCTTTGGTATGGGTATGGTGGCGGACTGAAATTTTTGGA
AAGATTTTCCTACATCAACTCCATCGTCTAT*CCTTGGACGTCCATTCCACTTCTGGCCTACTGCACGTTGCCGGCCATCTGCTTGTTAACGGGAAAGTT
CATCACTCCAGAGCTTAGCAATCTTGCCAGTATCTGGTACATGTCTCTTTTCATCTGCATTTTTGCTACTGGTATTCTGGAAATGAGATGGGCTCGTGTA
GCGGTTGACGATTGGTGGAGGAATGAGCAGTTCTGGGTCATTGGAGGTGTATCTGCCCATCTGTTTGCCGTGTTCCAAGGACTTCTCAAGGTGATAGC*T
GGTGTGGACAC*GAGCTTCACCGTCACAACAAAGGCTGGAGACGATGAGGAGTTCTCGGAGCTGTACACCTTCAAATGGACAACCCTGTTGATACCCCCG
ACCACCCTGC*TCCTGCTGAACTTCATCGGGGTGGTTGCCGGCATCTCCAACGCTATCAACAACGGATATGAGTCATGGGGGCCTCTCTTCGGGAAGCTC
TTCTTTGCGTTCTGGGTGATTGTCCATCTTTACCCGTTCCTCAAGGGTCTTCTTGGAAGGCAGAACAGGACCCCGACGATCGTCATCGTCTGGTCCATCC
TGTTGGCTTCTATCATCTCGCTCCTGTGGGTGCGTGTGAACCCTTTCCTTGCCAAGACCGACGGCCCTCTTCTGGAGGAGTGCGGTCTGGACTGCACCTA
GGAGATGAAAGGATGGACGATCAAAATGAGTCATCATGTGGAGTAATTTTGAAGGTGTTTTTGTGCCCATAAATTTTTTGTCTTCCATTCCTCCATCCCC
TGTGTAGATAGAAAACAAACATGCAACAAGTGTTAAGTTATTGGTTTTGTTCCATGGTGGGTAGCTGGGCCTCATATATGCAAAATATTTGGGCAGACGG
GAGGCTGCGGCAACCCTTCTTCACCTCACCTCTGTGCAGTTCGGCCACGAAGAAGCAAGGATACAGTCAGCCAAGTCAGTGTTGTTTCATTGTCCAGCCA
TCCAGCAATTCTTTATTTGTTGACCTTGATTTAAATGGAGAGGGATAAAATGTATGTAAGTGAGCCGAAACTGAGAGCTGTCGTCTGTATGCTATGCCCC
AAGGATTGTATTATGTATGTACAAACTGAAAACAACTTGTATTTTT*CT*CT*CTGTAAGGCAAGAATGCCGTTTGTAATAGAGGAAGCTGCAcattaTT
TATctagcttgttttggtaaaaaaaaaa
page-top