Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15145  (registered. 2007)
Contig Information
Length 993 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 4
Wh_r Root 3
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09713 [Oryza sativa Indica Group]
Score 953
Evalue 4.45632e-101
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15145
agcagagaaccacaacatcaacgtaactcaaagcgaagaacacgctAGTTCAaccaaagTCATACAATAAGGCAGTACCGTGCGCGCTAAG*AGCATTTA
GCATGTTTCACATGCCTCAGTGGAGCAAAATTTTATTACAGCCAACAAGATCCCTAGTGTTCCTCAAGACTAGCTAATAACTGTATTTAGAAGAAGCTTG
GGCTGCCGGTGCAGCTTTCACTTCTTCACCTCCTCGTACTCGGCCTCTGGGGCCTGGTCACCTCCGCCCTGCGACCCTCCTTCCTGGGAACCACCACCAG
CCGCGCCGCCTCCAGCCGCACCACCACCAGACATGTGCTCCCCGAT*CTTTGAGACCGCCTTGTTGGCCGCTTCCATCTTGCCCTTTATCTTCTCGATGT
CGTCAGAGGCCATCTCCGCACGGAGATCAGCAACCGCTGTCTCGATCTCGGTGGCAACCTCCGCCGGGATCTTGTCCCTGTACTCTCCCAGGCTCTTCTC
GATGCTGTAAATGGTGGTGTCTGCAGTGTTTCTGATGTCAATGAGGGCCTTGCGCTCCTGGTCCTTCTGTGAGTGCAACTCAGCCTCCCGCACCATCTTC
TCGATCTCTGACTCAGAAAGCCCACCGGACGATCGGATGGTGATCTGCTGCTCCTTTGCGGTGGCCTTGTCCTTTGCAGAGACCGTCACGATTCCGTTGG
CATCAATATCAAATGTGACCTCAATCTGTGGCAGTCCTCTTGGGGCTGGTGGGATGCCCACAAGATCAAACTCGCCAAGAAGTTTGTTGTCTGTTGCCAT
CTCACGCTCACCTTGCAGGACACGGATACCCACTTGCGTCTGGTTGTCAGCAGCAGTTGAGAACACCTGGCTTTTCTTTGTGGGGATTGTAGTGTTCCTG
GTTATCAGTCTGGTgaagataccaccaagagtctcaataccaagtgaaaggggggttacgtcaaggagaagaagccctcgtgccgaattcctg
page-top