Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15124  (registered. 2007)
Contig Information
Length 1203 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 16
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_033126 [Oryza sativa (japonica cultivar-group)]
Score 271
Evalue 7.16953e-22
Total Hit Count 149
Registered year 2007
Contig Sequence     [ Download ]
>Contig15124
tgggtgtaagtgtggtggtgtcgtgtggtgtctcctgctcgccgggctccttctcctggccgtggcctccgcggcggagcgggacacggagaaggaggag
gagatccggttgtgcaagaaggtctgcgactggaaggcgggggaggacaccgggaaggccagggagtgcAAGGAGCAGTGCGAGCGCCGCCGCCACGGCC
ACGAGCTGCTCCAGGAAGACGGCGACAGCTTCGACAGCTGCGTGAGCCAGTGCCGGGGCCATGGGGGCTGGTGGGGGAAGGAGCGGTGGGAACGGTGCAG
GCAGATATGCAGGCAACGCCAAGAAGGGGAGGGGGGCGACGACGACTTCGACGAGGGCGACAACGCCGACGACAGGTGCGACAGGATGTGCCAGCGCTAC
CACGACCGGCAGG*AG*AAGATGCAGTGCATGAAAGGCTGCAGACATGGCGAGTCCGGCCTCCTCCGCTCCGACGAGGGCCACAAACACGGAGACCGCTG
CCAAACACAGTGCAAGCGCTTCCGGCCCGGG*TCATACGACAGGCAGCAGTGCATCGAAAAGTGCCAGTGCCAGCAGAAGGAGGAGGAGGAGGTGATGAA
CCACCACGGCGGCGGTGGCCATGGCCACGGAGACCGCTGCCAAACGCAGTGCAAGCGCTTCCCGCGCGGGTCGTACGACAGGTGGCAGTGCACTGAGAGG
TGCCAGAGCCATCAGCAGGACGACGAGGAGCTGATGAACCACCACGGCGGCCACGAAAGCAGCAGCTGCGAGCAG*AAATGCCAGCAGCGACACCGCCAC
GAGTACGATAGGCAGCAGT*GCGTGCGAGACTGCAAAAGCGGCGGTGGCGGCGGCGCCGGTGGGCGTGGCCGCGAGGGCGACGAGCGCCAGCACGACAGG
GGGATGGTGGTCGAAGCCATCCTCGAGGAGGTGTAACGGCTGGATGAAAGTAGCCAGCTCTTTCCAGGAGCTCGACCTCTTTACCGGTCTTGCATCTTGC
TATGCGTACGTGGTAGGTGCATGTGTGAGCTACAATAAATTGCGGTAACTAGAAGTGGCTCTCCAGCCTTGGAGAGAGCCTGTGTACGAGGAATCAATCT
GGAAAGCAATGTGGTGATGTGTCATGTGTGATAAATAAAATAAGCAAGGTTTCGAAATTAAGCCCCCAAAAtatctgaatcagctcaagatataaaaaaa
aaa
page-top