Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15099  (registered. 2007)
Contig Information
Length 1107 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 16
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gamma-gliadin [Triticum aestivum]
Score 442
Evalue 9.3848e-42
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15099
agtaggtagtagttaacGCAAATCCCCATGAAGACCTTACTCATCCAAACAATCCTCGTGATGGCAATAACCATCGCCACCGCCAATATGCAGGTCGACC
CTAGCGGCCAAGTACCATGGCCACAACAACAACCATTCCCGCAGCCTCACCAACCATTCTCCCAGCAACCGCAACAAACATTTCCCCAACCCCAACAAAC
ATTCCCCCATCAACCACAACAACAATTTTCCCAGCCTCAGCAACCACAACAACAATTTATCCAGCCCCAACAACCATTCCCCCAACAACCACAACAAACA
TATCCCCAGCGACCACAACAAC*CATTCCCCCAGACTCAACAACCCCAACAACCATTTCCCCAGTCCCAGCAACCACAACAACCTTTTCCCCAGCCCCAA
CAACAATTCCCGCAGCCCCAACAACCACAACAATCATTCCCCCAACAACAACCATCGTTGATTCAACAATCTCTACAACAACAGTTGAACCCATGCAAGA
ATTTCCTCTTGCAACAATG*CAAACCTGTGTCCTTGGTGTCATCCCTCTGGTCAATGATCTTGCCACGAAGCGATTGCCAGGTGATGCGGCAACAATGTT
GCCAACAACTAGCACAAATTCCTCAGCAACT*CCAGTGTGCAGCCATCCATAGCATCGTGCATTCCATCATCATGCAGCAAGAACAACAAGAACAACGAC
AGGGTGTGCAAATCCTGGTGCCACTGTCTCAACAGCAACAGGTAGGTCAAGGTACTCTCGTCCAAGGTCAGGGCATCATCCAACCTCAACAACCAGCTCA
ATTGGAGGTGATTAGGTCATTGGTGTTGCAAACTCTTGCAACCATGTGCAACGTGTATGTCCCACCTTACTGCTCCACCATCAGGGCACCATTTGCCAGC
ATAGTCGCCGGCATTGGTGGCCAATGAAAAAAAAGCAAGAGCTATACTAAAAGGTAGATAGGTCAACGTTGCTTAG*CTTATGCACCAATCGATGTAACG
ATGACAAATAAAGTGGCGTGCACCATCATGTGTGACCCCGACCAAGTGCTAGTTCAAG*attggg*aATAAAAG*ACAAACAAAgttcttgtttgctaaa
aaaaaaa
page-top