Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15082  (registered. 2007)
Contig Information
Length 1194 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 5
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypersensitive induced response protein 3 [Triticum aestivum]
Score 1450
Evalue 1.36756e-158
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15082
gggggaacgaacacaacagacgccgtCCTCCTGCCACTTCACCTCTCCCACCTTTCCCCACTCTTCTCCAACCCCcgG*ACGCAGGTACTACCAG*AAGT
GATCGGAAGCCTGCAGTATGGGCAATCTGTGCTGCTGTGTTCAAGTTGACCAGTCTACCGTGGCCATCAGAGAGCAGTTTGGGAAGTTTGACAGTGTGCT
TGAGCCAGGATGCCACTGCCTGCCTTGGATCTTTGGGAAACGTGTAGTTGGCCATCTCACACTCAGGTTGCAGCAGCTGGATGTGCGCTGTGAAACCAAG
ACAAAGGACAATGTGTTTGTCACTGTTGTTGCATCGATTCAGTACCGACCTCTGGCTGGCAAAGAAAGTGACGCATACTACAAACTGACCAACACAAGAT
CCCAGATTCAAGCCTATGTCTTTGATGTGATCAGGGCAAGTGTTCCAAAGCTCAACCTGGATGATGCTTTCGTGCAGAAGAACGATATAGCAAAGGCTGT
GG*AGGATGAACTTGAG*AAGGCTATGTCCGCATATGGCTTTGAGATCGTGCAGACCCTCATTGTCGACATCGA*GCCGGATGCGCATGTCAAGCAGGCG
ATGAATGAGATCAATGCAGCTGCAAGGATGAGGGTGGCTGCAAACGAGAA*GGCGGAGGCTGAGAAGATTGTCCAGATCAAGCGTGCCGAGGGTGAAGCA
GAGGCCAAGTACCTGTCTGGCCTCGGTATCGCCCGCCAGCGCCAGGCCATTGTGGATGGCCTGAGGGACAGCGTCCTGGGCTTCTCAGTCAACGTGCCTG
GCACCACTGCAAAGGATGTGATGGACATGGTGCTGATCACCCAGTACTTTGATACTATGAAAGAGATCGGCGCATCCTCCAAGTCCTCGGCGGTGTTCAT
CCCCCATGGCCCTGGTGCGGTGCGCGACATCGCCACGCAGATCCGCGATGGTCTTCTTCAAGGCCAGTCTGCCTCTGACAACTAGCAGTTGGCTTTGCCG
GCATGAACTTTGAAGCTGGTGGTGGTTTGTGGTTTGCTAGCTATTGCTTAGAGTACTGTCTAATATGATGCATGCCGTATTATTATGAACTTATATGGAA
CCATATGTGGATCGTGGCGTGCCATGCCTTAGGTTGATGTGCGGTAACAAAACCTTTAACCTTGTGGGAATGCAGGATGATATAAGTGTgttat
page-top