Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15078  (registered. 2007)
Contig Information
Length 1032 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_r Root 6
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group] >gi|125601289|gb|EAZ40865.1| hypothetical protein OsJ_024348 [Oryza sativa (japonica cultivar-group)] >gi|215769010|dbj|BAH01239.1| unnamed protein product [Oryza sativa Japonica Group]
Score 824
Evalue 4.27795e-86
Total Hit Count 28
Registered year 2007
Contig Sequence     [ Download ]
>Contig15078
cagtgccacacccaacaaagttgaagttctggctttagctaaatgttcaaagATGAAAGATGTGgttcaatAATGCACATCACCTGACCACAATATCCCA
AAGCCGTTGCCAATTGTGGTCAAAGGAAAATACTGAAGAAAAAAAGTTTTGATCCCGAACCTCGCGGCATGTATATGCTACTGTACTGTGGTGTCAACTG
GACCGAGTAGAAATGACAATCTGAAAGATACAGAAACGACTGACACGGGCATAAGATCAACACGCTCATTTGCAGCGGTGTAGCACGCGAGATGAGCAAC
ACAACATTTATCTTCTCACTTCATCAGCAAAACTACGAACCCTACCAGCGAAACAATCATCCAGCTGAATGGCTGGACCGAAGGAGCCCAGTTGGAGCCC
GGGGGAGCAGGGGAGTAGTCGCCGGAGTCGGTGCTGGTGCTGAGCACGACGACCACCCAGTCCCCCTCGTTGGCGATCCCGACGCCGGAGTACTTGGTGT
CGTTGAGGAACCGGTTGTACTGTGACTTGGTGTAGTTGGTCAGCACAACGTCGGCCACGAGTCCGGGCACGCATGCCGGCATCACCTGCCCGTCCTCGGT
CACCG*ACGCGTTGAGGTGGCAGCGGTCGAGGAACTGGGGGTAGTCGGGGAACTGCGGCTCGGTGCCGGGGACGGTGTTGGCTCCGGTGGTGTTGGTGCA
CTCCTGGCCCTTGAACTTCTTCGCTAGCTGCTCGGCCAGGCAGTCGGCATTGCTGTTCTCGGTGAGCGCCGGGACCTTGAGTGAAGCTCTGTAGCTGTTG
ATCCCCTTGAGGAGCTGGTTGTCCTCCCCGTCAGATCTGGCGGGGTGCAGGAGGGAGGAGGCGACGGCCAGGAAGCAGAAGAGGGCGGCCCTGGAACTGG
AACCCATTTGCCCCGACAATCCACCGAGCtccaccgctgcgcgcaccctccgacgggtagggtggcgggtatataggggggagtgaggaggaaggaagga
aggaggcgagctgctgctgtctgcggccaacc
page-top