Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15075  (registered. 2007)
Contig Information
Length 1562 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_e Seed DPA10 9
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100217260 [Zea mays] >gi|194698300|gb|ACF83234.1| unknown [Zea mays]
Score 506
Evalue 5.64407e-49
Total Hit Count 87
Registered year 2007
Contig Sequence     [ Download ]
>Contig15075
gaggcccaTTCCGCAATGGGGGCCCTGCCTCGGGGTCTGCTGGTCCTCGGCGTTTGCGCCGTCCTGGTGGCGGCCGTGCTCGCCGACGCATCGCCGGCAT
CGTCCATGGTCGTCGGCTTGGCCAAGTGCGCCGACTGCACCAGAAAGAACATGAAGGCTGAGGCTGCTTTCGCGGGCCTCCAGGTGGCTGTCAAGTGCAA
GAACGCCCACGGCGAGTACGAGACCAAGGCCATCGGCACGGTGGACAAGTCCGGCGCGTTCGGCGTGCCCCTCGGCGCCGACCTCCTCCGCGAGG*ACGG
CGAGCTGAAGCAGGACTGCTTCGCGCAGCTCCACAGCGCGCCCGACCACCCATGCCCCGGGCAGGAGCCGTCCATGATCGTCCGGCAATCCGCCGACGGC
GCCGAAAAGAAGAGCTTCGTCGCCGTCCCCGGCGAGGTGCACTACTCCTCCCAGG*AGTGCGCGTCGGCGTTCCTCTGCCACTTCTTCCACAAGAAGCAC
CTCTTCCACAAGAAGCCCGCCTTGGTCGTCCCTCACCTCAAGAAGAAGGCCATCGTGATCCCGCACATCCACAAGAAGCCCATCGTGATCCCGCACATCC
ACAAGAAACCGGCGCCGGTGCCGGTGCCGGAGTACAAGCCGCCGACGCCCACCCCGGTGTACACGCACCccgAAG*CCCGTGCCAGAA*TACAA*GCC*G
*CCGACGCCGG*TGTACCCG*CACCCGGGCGCCGATCTACCACCCTCCT*G*CCGCAGATCAGAAGGCCGCTCTGAATCCGG*AGACTGACCCTCAGCTC
TTCAAGAAGCTCCTCCACAAGAA*GCCCATCGTGAT*CCCGCACTTACCAA*TCGTGATCCCTCACTTCCACAAGAAACCGGCGCCGGTGCCGGTGCCGG
AGTACAAGCCACCGACG*CCCACCCCGG*TGTACACGCACCCGACGCCGGTGCCAGAGTACAAGCCACCGACTCCGGTGTACCCGCACCCGTCGCCGATC
TACCACCCTCCTGCCGCCGATCAGAAGACGGCTCAGGACCCGGAGACGGACCCCCAGCTCTTCAAGAAGCTCCTCCATAAGAAGCCCATCGTGATCCCGC
ACTTCCACAAGAAGCCAGCGCCGGTG*CC*GGAGTACAAGCCGCCAACACCCACCCCCGTGTACACGCACCCGACGCCCGTGCCGGAGCACAAG*CCGCC
GACGCC*GGTGTACACGCACCCGACACCGATCT*ACCACCCTCCT*GCTGACCAGAAGATGGTGCAAGACCCGGAGACGGACCCTCAGCTCTTCAAGAAG
CTCCTGCCGTTCATCAAGAAGAACCCATTCTTCAAGAAGTTCCCCCCTGCCAAGGAGGATACCAAGCCATAGAGGATTGGTGCGACCTGAAGTCCTTTGC
CTATTTCAGTATCCATGGCCGTGTTGATTCCTGCAGTTTCTTTTTTCTTTTAAGGGAAATGTTGATCCCCGGTAATCTCGAACTTTTTTT*GCAGGTGTG
GTAGTAGT*CTTGAACTTGCTACAAATAAACCTATGTTGAAATGAGTTATATAaaaaaaaaa
page-top