Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15069  (registered. 2007)
Contig Information
Length 1803 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 2
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_005318 [Oryza sativa (japonica cultivar-group)]
Score 2049
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15069
cttattataCTTGACCGTACTGCTATAGCAGCAACTGTTTAAACGAAACCAACACATCTCACAACTGTTTAAACGAAACCAACACATCTCACAACTGTTT
AAACGAAACCAACACATCTCACAACTGTTTAAACGAAACCAACACATCTCACAGGG*ACTCGATGGTCCATGAAACCAGACACGGTAGGACTTGACACAA
ACGAGACTTAACACTTCACACGAGCGACAGGGGCACCCACCAGAGTACTCAGGGCATTTACTGACCACCGCGGAGGCGGAGCACCAGGTGGAGAGTGGAT
TCCTT*CTGGATGTTGTAGTCAGCGAGGGTGCGACCATC*CTCCAGCTGCTTGCCGGCAAAGATGAGACGCTGCTGGTCCGGGGG*AATGCCC*TCCTTG
TCCTGGATCTTGGCCTTGACGTTGTCGATGGTGTCTGA*GCTCTCAACCTCCAGAGTGATGGTCTTGCCGGTAAGGGTCTTCACAAAGATCTGCATACC*
ACCTCGGAGACGCAGGACAAGGTGAAGGGTGGACTCC*TTCTGGATGTTGTAGT*CAGCAAGGGTCCT*GCCATCCTCC*AGCTGCTTACCAGCAAA*GA
TGAGGCGCTGCTGGTCCGGCGGG*ATGCCCTCCTT*GTCCTGGATC*TTGGCCTTGACGTT*GTCAATGGTGTCTGAGCTCTCAACCTCCAGAGTGATGG
*TCTTGCC*GGTGAGGGTCTT*CAC*AAAGA**TCT*GCATACCACC*TCGGAGACGCAGGACAAGGTGAAGGGTAG*ACTCCTTCT*GGATGTTGTAAT
CAGCAAGGGTACGGCCATCCTCCAGCTGCTTGCCAGCAAAGATGAGGCGCTGCTGGTCCGGGGG*AATGCCC**TCC*TTGTCCTGG*AT*CTTCGCC*T
TGA*CATTGTCTATGG*TGTCCGA*GGACTCCACC*TC**AAGTGTAATGGT*CTT*GCCAGTga**gggtctt*cacaAA*GATCTGCATGCCTCCcTC
GAA*GACGCA*gcacaA*GGTGGA*GGGTGGACtcctttcTGGATGTTGTAGTCA*GCAA*GGG*T*CCTGCCGT*CCTCCA*GCTGCTT*GCCAGCGAA
*GATGA*GACGCT*GCTGGTCCGGGGGAA*TGCCCTCcctTGTCCTGGATCTTTGCC*TTCACATTGTCGATGGTGTCGGA*TGACTCCACCTCAAGCGT
AATGGT*CTTGCCAGTGa*gGGTCTTGACAAAGATCTGCATGCCTCCACGAAGACGGaggacAAGGTGGAGGGTGGACTCCTTCTGG*ATGTTGTAGTCA
*GCAA*GGGTCCTGCCGTCCTCCAG*CTGCTT*GCCA*GCAAAGATGAGGCGCTGCTGGTCCGGGG*GGA*TGCCCTCCTTGTCCTGGATCTTTGCCTTC
ACATTGTCGATGGTGTC*GGATGACTCCACCTCAAGC*GTAATGGTCTTGCCAGTGAGGGTCTTCACAAAGATCTGCATGCCTCCACGAAGACGGAGGAC
AAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCAGCAAGGGTCCTGCCGTCCTCCAGCTGCTTGCCAGCAAAGATGAGGCGCTGCTGGTCCGGGGGG
ATGCCCTCCTTGTCCTGGATCTTAGCCTTGACATTGTCGATGGTATCAGACGACTCGACCTCAAGGGTGATGGTCTTGCCAGTGAGGGTCTTGACAAAGA
T*CTGCAT*CTTGGGGCGGCGGGGAGGA*CCGG*AGGAAGGGGAG*CTGG*AGTCGATCGGAGACGAGATTGGCTTGGGGATTTGTTGGTTCCGTTCGTC
Gga
page-top