Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15012  (registered. 2007)
Contig Information
Length 741 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_h Spike at heading date 6
Wh_r Root 2
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11612 [Oryza sativa Indica Group]
Score 611
Evalue 1.19512e-61
Total Hit Count 113
Registered year 2007
Contig Sequence     [ Download ]
>Contig15012
gggaaaaacacccaaaaagg*cgGCGG*AAAGGGGAGAAGGGAAG*AACATGG*ACGGGCACGTCGG*CCAGTTCTTCCAGTCGGTCAGCTCGATCTTCC
GCGGGAGCGACACCCTCCCCGTCTGCGACCGCGACATCATCGCCGGTTGTGAGACAGAGGTTGCTGAGGCTGCAAATGAAGAACAGAAGAACGAC*AGCC
TCATGAGGCTGTCATGGGCGCTTGTTCACTCTAGGCAGCCCGAGGATGTCAACCGTGGCATTGGAATGCTTGAAGCTTCTTTCGGCAAGTCTAACAGTCC
GCTACAAACAAGGGAGAAGCTCTATTTGTTGGCCGTTGGACACTACAGAAATGGGGATTACACAAGAAGCCGTGAGCTTCTGGAAAGATGCTTAGAGGTT
CAACCTGACTGGAGGCAAGCTCTTACTTTGGAAAGGCTCCTTGAAGAGAAAACCAAAAGAGATGGTATGATTGGCATGGCCATTGTGACCGGCGCCTTTG
GACTTGTGGGGCTTGTTGCTGGTGGAATCATAGCTGCTGCTTCATCGTCCAGGAAGAAATGAGGCTCCGGTATGCGGTGAATAAGATGATTAGATGAGCA
AGAACTTGATGTGAAGTTGCGTAATCTTACCTTGGCACTCTTGCGACCATGCATGTGCGCACTTATCCTTGTCCTGTCCTGTTTCCATGTTGGACCAACC
TTAATCGCACTATTAGTAAATACGACATTTCAAaaaaaaaa
page-top