Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14989  (registered. 2007)
Contig Information
Length 515 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_dL Crown of seedling 4
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone H4 [Zea mays]
Score 410
Evalue 9.92834e-39
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14989
gatcCAATCTGCCCGCTCGCAGCTCCACGGAAGGAAGCCGC*GTCAACCATGTCGGGCCGCGGCAAGGGCGGGAAGGGGCTGGGCAAGGGCGGCGCCAAG
CGCCACCGGAAGGTGCTGCGGGACAACATCCAGGGCATCACCAAGCCGGCCATCCGGCGGCTGGCCCGGCGCGGCGGCGTGAAGCGCATCTCGGGGCTCA
TCTACGAGGAGACCCGCGGCGTGCTCAAGATCTTCCTCGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGACCGTCACCGC
CATGGATGTCGTCTACGCGCTCAAGCGCCAGGGCCGCACCCTCTACGGATTCGGCGGCTAGGCCCCCTGCTCCGTCCAGTCTCTGCTC**CCggcTGTTC
CATCTGTCCGACTGCATGTGTa**tgaatCGTTGGTGAGGgtTTGGTCTgtgtagTTAGtgcaagGCGATGTGTATGAATGCAAtggggaatcagagtTG
GTATtaaaaaaaaaa
page-top