Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14895  (registered. 2007)
Contig Information
Length 1100 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit TaWIN2 [Triticum aestivum]
Score 1142
Evalue 6.29496e-123
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14895
ttttttttttaaacaccgaacatGCATAGCTGTTTGATTATAGGAAGCA*GAGTTGACAACCCTCTGGTT*AAATCTGAAGGAAGCCGTGCATACACGAG
CAGTATTCAAGTTGTAAAGTAAAATAATGCACGAGGACGGCGATGTATAACAATATAACGAAAGAAAGGGTAGGTAAAAGACCAAGCAACAAAGGACACA
CGAAAATGGTCCTTGTACAAGCATCATAACTACCCGAAGGTTAAGAGAGAAAGAGGGCAGTAGCTAGGACCCTTCACTACTGCTCATCCTCAGGCTTGCT
TGAATCCCTCATTTCATCGCCAGCGTCATCCTGCATATCAGAGGTCCACAAGGTGAGATTGTCACGGAGAAGTTGCATTATCAGGGTGCTGTCCTTGTAG
GAATCTTCTCCGAGGGAATCCAGCTCAGCGATGGCTTCATCGAAGGCCTGTTTGGCGAGCGAGCACGCACGATCAGGCGAGTTGAGGATCTCATAGTAGA
ACACGGAGAAGTTGAGCGCGAGGCCCAGTCTGATGGGGTGAG*TCGGTGGCAGCTCCTTCATGGCTATGTCCTGAGCGGCCTGGTAGGCACCGAGGGTGG
AGTCAGCGGCATCCTTGCGCTCGGCGGCCGACTTGAACTCCGCGAGGTAGCGATGGTAGTCTCCCTTCATCTT*CAGGTAGAATACCTT*GGCGTCGACG
GCGACGGCGGCGGGGACTAAGCGTTCGTCGAGGAGACGGAGGATCCCCGCGCAGATGTTGGAGAGCTCGGCCTCGACAAGTGCGCGGTACCCGCGCGCCG
CGGCGGCGTGCCCCGCCGCTCCGCGCCCTTCCTCCTTCTGCTCGATGGAGGACACGATGCGCCAGGAAGCACGACGCGCCCCAATGACGTTCTTGTACGC
GACTGAGAGCAGGTTCCTCTCCTCGACGGTGAGCTCGCCGGTCCCCGCCGCCGCCACGACCTTCTCCATGAACTCGACCATCTCCTCGTACCGCTCGGCC
TGCTCCGCCAGCTTCGCCATGTAGACCATCTCCTCCCTCGTTCCCGCTGCCGCTGCCGTTGCCATCGCTGTCGACGATCTGGTGTGTGCGCGTGGGCGtg
page-top