Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14858  (registered. 2007)
Contig Information
Length 655 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 14
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit CM 17 protein precursor [Triticum aestivum]
Score 671
Evalue 1.02449e-68
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14858
ttttttttttaAGAAGCGAAAATGATTCCCTTTATT*CTTATTATCCATATATATAGCAG*ATAGCACCACACATGA*TGAGCGCGCGGAGCTCGTCCTA
TATGTATATATGCATGTCACACATGTATGGTCGCAACATGCTTATTTATTCATGAGCGAGAGAATTGTCTCTAGCTCCACTGAGACTCCTCCATACCGAG
GCAGTATGGGGTGTTGTGAACGGTCGTCAAGTTGCAGTACCCCGGAGTGACGAGTATTGGGACGAAGTTCATCTGCACCTCCCTAGGGCATCCGGGGAGT
TCCATGAGGCCGCTCTGATCCGGGCGAGACTTCGGCCCCATGAAGTAGCGCAGCGCCTGGCATCGGCACTGCTGCGGAATGTTTGCAAGCTGCTCACAGC
ACTCCTGCTTGGCGAGGTACGGCGGCCCGGGCATTTCGATACGACATGCTTGTTCTTCCACATAGTTACGGCAGCTTGGGAGTGGAGTGATCAGAGTACT
CGTCCATGGGGTGCAATCTTCATTGCCGACGGCGGCAACGGCGGCAAAGATGAAGACTAGGAGGGCCGCGAAGAGGAGATTGTAGTTGGACTTGGACGCC
ATATTTTTGGATGGAGGCCAAGTT*CGTTGGTGTGGTTTTTTCCCTGCagcccgg
page-top