Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14812  (registered. 2007)
Contig Information
Length 1025 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 3
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_018535 [Oryza sativa (japonica cultivar-group)]
Score 450
Evalue 2.36828e-44
Total Hit Count 177
Registered year 2007
Contig Sequence     [ Download ]
>Contig14812
ctcgcaacagaggacattagaaacctgaagatgacggacaaaggaACGAGCAATTTATAGCCTACAAAATTCTGACAAGCGACAACCGTCGGATTTACAA
AGTCGACAGACACAGGGA*TGAATGGTCCACATACAGCAGAGTTATTTGCTTCAACATAAGTATCCGCGCAGAAATATATGGTGATAGGAAAAATTAAAC
TTGACAGGCGACGGTATCGGTGAAGGTGGTACTTGAGACGGTACAGCAATCTCACTTCCCACCGAGGGTTGGGAACTGGTTCTGGTCCTGAATTGCCGGG
GCAGGCGGTGGGCCGTGATAACCCCCACCACCAAATCCACCTCTGAAGCCTCCGCGGTCTCCACGGCCCCTGCCGCCACGG*CCACGGCCTCCATAGAAC
CTTTCTCCTTCAGCAGGCTTCAGGAACTCATTGATGCTCACAGACTTCTTAGCACGCTCTTCACGTTCAGCATTCTCTTTCTTCTTCAAAGCCTCCTTAT
CAGCACCCAGTTTGATGAAAACTTCATCATTTCCTTTCTTGGTGGAAAGTAGTTGCATAGCCTGCAGATCCTTATCGATTTCAACCTTCCTCTCTTCAGA
CTTCTTCAAAGCAGCAAGTGCTTTCCTCTTCTCCTCCATTACTTTCTCAAATTCATCAAGAGTCAT*CTCATTATCCTCTTCCTTTTCTTCCTCCACAAC
TGCAGCGCCATCTTTGGTGGCCTTGTTCTCATCTGCCTGTGGTGCATCCTCCGGTGCGCCCTGCTTCTCAGGTGCAGGGG*CCTTCTCATCCTGCTTCAG
GGCCTCAGTTTCCTGGGCAACAATTTCATCAGAGGTAGTTCCCCAGTTCCCACGGCCAGCACCCTCGCGTTTTATCTCATACCCACGGCCTGTGCCGCTT
TGGCGCTCATAGTTCCTTCGaggtggcCTCTCAGAATCATCACCAAACTCACCATCACGATACCCACCACGACGgccaccccccggtagggttgcctagg
ggccctctctctatcctgggcgccc
page-top