Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14802  (registered. 2007)
Contig Information
Length 862 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_19723 [Oryza sativa Indica Group]
Score 526
Evalue 1.15145e-51
Total Hit Count 365
Registered year 2007
Contig Sequence     [ Download ]
>Contig14802
gcATGAAAAAGAAGctcatTCGACATTGCTT*AGGTCTTTGCTAATACAGAGCAGCTCAAAGTTCACACACATGACCACCAAACGTTACAACTCATGTAT
TCCCATGTAAACAAGGAAAAACTGACATAATATCACAGGCTGGGCACGGCTAGTTCGTCAGTTCCATGATAGCACTGACTATGTCACCGTCAGCAGACTT
GAGCGCCTTCACAGCCTTGGGCCTAGGCACACCGGCCTGGGTCATCACCAGCTCAATGTCCTTCGGCTCAACCCC*AGTCTCATCACAATCCTCGTCATC
CTCCTGAACAGCTGTAGAAGCCTCAGGGTTTGAGATGACGCTGCTAAGATCAGGCGCCTTGAATTGCTCGGCGGCCTGGGACTGCAGCTGTGAGCTCAGA
TCCTCAATCTTAGCTTCACCGAAAATGACATAGGTGTCAGAGGCAGGGCTCTTGAATACATCTGGCTTGGAGATGACAAACAGGATATTCTTGCTCTTCT
TGACAGTTACACGGCTGACGCCAGTGATAGTCTTCATGCCAAGCTTCAGCATGGCCTTCCTGCTCTTCTTCTCACTCCTACTCTGCTTAGATCTTCCACT
TGCATCAACTCCTTCCACGTCATCGTCTTTGTCATCCTGGTCATCATCATCCTCATCTTCCTCATCATCATCATCCTCAACTACAGGCTCATCTCCCTGC
GCCGCGAGCTTCTGCTCTTCCAGGACGGCGCGTAGCAGCTCCGCCTGCGTCGCGGTCTCGGCCGTCATGGTGGTTGGGTGGGCGGGTGGAGGCGCCGGCG
CTGCTGGAGAAACCCTAGAACCCTAAGTTGGAAAGTGGGGGCTgtggaggcgcaagcaaagc
page-top