Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14788  (registered. 2007)
Contig Information
Length 692 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_yd Spikelet at late flowering 5
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_07364 [Oryza sativa Indica Group]
Score 407
Evalue 4.65894e-38
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14788
gcTCGCAGCCTCCCAGTCCCACCCACACAAC*CGAG*AGAG*ATGAG*CACCGGCGGCGCGGACAAGTCCGGCAGCGGCGGCGGAGGAGCTGGTGGGCCG
GTGAAGACGCCGTCTGACTTCCTCAAGTCGATCAGGGGCCGCCCCGTCGTCGTTAAACTCAACTCCGGCGTCGACTACCGAGGTATTCTGGCCTGTCTGG
ATGGTTACATGAACATCGCAATGGAGCAAACTGAAGAGTAC*GTGAACGGCCAACTGAAGAACAAGTATGGAGATGCTTTCATAAGAGGCAACAACGTCC
TCTACATCAGCACGTCGAAGCGGTCCCTCACCGACGGAGCATAGGCGGAGTGGAGCATTCACATCATCATGTAATTTGAAGGTCGTTAACCCGATTATTG
GTTGTGGTGATCTGACTGGTGCTGCCTTTGTCAAT*CTCGTACCTCCTGTCTGCTGTATTGCCTGCTGATGG*AGACTTATCTGGAACCATTACGATTCG
ATGTTATCTTGTGTTTTTAGCTTGGAGATGTTTGTGGCCAAGATTCTGCGATCAGGATATAGATAAGATTTGTGTTT*CCATGGTCGTGTGCTG*CTTAG
AA*CAGATATTACGTATCTTATAAGACACACCCATTGTGCTACCATCGGTGCG*ATGTTTTTGTTGGCGCTTTGCTctacaaacctacactg
page-top