Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9362  (registered. 2012)
Contig Information
Length 1555 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 1
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VWD Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115448905|ref|NP_001048232.1|| Os02g0767500 [Oryza sativa (japonica cultivar-group)]
Score 628
Evalue 7.00E-178
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9362
TTTTTTTTTTCTAACCATCCAGAAACTAACACACAACATGCCACGATATCAACAGCATGGAATTGGAGGTAAACAGGAGTATATGGGAGTTCCTCAGTAC
AGGTGATGGCAAAACCTGCGCTCTAACAGCCTTGCTGTCCTAAAACTTATTATGTCAAGCATCAAACTTCCCGGGGACAAAAAAGGCCTATTTCGCCTGC
TTAATGAGTTCCTCTCATCAAAATGATGACACAATAACCATCTGCTACAATAACAAAAGATTTCGGTTGCTAAACTCAAGTAATTGATACAGTCCCCATC
CACCAATACCACATCATCCCGGAATACATCGTCATCGTCGTAGTAGGAAAAATCAATCAAGCGCTGGCTTTCGCTGCTTCCTCTACCGGAGCAACTGGTG
GAGCACCGCCGGTGGTCGGGAGTCCAACCATGACCTTGAACGCGTCATAGATTCCCCACTGAGCACCGGTAAGAGTACCAATCATGACGATACGAAGGGG
TAGCCCTCTTGTGAAAAGGCCCAACATGCCAATCTTGTTAACAGCATCACCCACTGTAGCACCCTTGGCATTGTTGAGGAAAGAGACCAGGTTGTCAGCA
GGGTGAGAAACAATAGCACAGAAGACACCGGCAATGTAGCCACCAGCAAAGCTGATACCCAACTGGGAAGACTTGCTGCACTCGGCCTTGGGAACAGGAA
CAGCGTGCTTGTAGATAAGCTCAACAATGGTCTCAAAGGAGGCAAACTTCATCATGGTGTAAGGAATCTGGCGACCCCAGAGTGGAACGATGCCCTTGTA
GAGCCCAGCAGCACCCTCAGCTTTGATGAACTTGGGAAGCCCGTCACTCAACCCACGAGCAAATCCAGGCTGTGTCTGCACACGGACCTTGACAGCTTCA
AAGGGGCACAGAGCAATATCAGCAATTACCTCAGCAGAAGCTGAACCTGCAAGGTAAATCAGGGTCTTGTACTTCACGGCATTCTCAGGCCCAGCCATAT
CTGAGTAGGTCTTCTTAAAGAACTCGTAGAACCCAAACTTGCAAGCCCCCTGAGCACTGTAACCAAGCAACGTAGGCACCCATCCCCTGAAGAATCCCCT
AGCTCCTTGCTCCTTAAACAGAACACCAAATCCAGATGTGATGCTCTTGTATTTGGCCGGGTCAATCTGCATGTTGCACTTGACGAGGTCGAGCGGGGTG
ACGGCCATGTGGGTGAGGCCGCAGCTGGCGATCCCCCCGGCGGTGCAGGCGGCGTAGAAGGCCGGCGAGTACATGACGATCTTCTCGTTGGGCGCGCGGA
TCGAGAAGGGCCTGCCGCCCCCGACCCCGCCAGCGCCGACGAGGCCAGCAGCCGGGGCCGCGGCGGGCGAGGCGGGCGCCTGGTAGGGCGACGGGGAGGA
GGGGAAGCGCGGGGCGGCGGCGGCGAAGGAGCGCGAGGAGTAGAGGAAGCTGGGGAGGAGCGAGTCGCGGGAGAGGTCGGAGAGCGCCATCGCCGCCGGG
CCGGGAGATCCGGGCGCGGATTCGCGGGGGGCTGCGGCGCTGGCGGTGCTTCCGA
page-top